 |
|
 |
PLEXdb is committed to making
expression data publicly available to researchers world-wide...
|
|
 |
|
 |
|
|
|
Barley1 22k Microarray Sequence ID: Contig74_x_at |
|
|
|
Sequence Type
|
Exemplar sequence
|
|
Probe Set Details
|
Probe Sequences & Alignment
EXPRESSION DETAILS for Contig74_x_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig74_x_at
|
|
Alignments and Assemblies
|
• Barley1 GeneChip Assembly
• Barley1 GeneChip Assembly 25 contig and alignment
• PlantGDB PUT assemblies
• GrainGenes Blast
• HarvEST: Barley 21 Assembly
• HarvEST: Barley 25 Assembly
• HarvEST BLAST
• PLEXdb Blast
• TAIR Blast
|
|
Model Genome Alignments
|
• Rice Alignment at Gramene (by locus name): LOC_Os09g17740.1, chlorophyll A-B binding protein, putative, expressed, Expect:2e-16, match=37/38. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits
• Brachypodium distachyon Alignment at Brachybase: Bradi3g42620.1, , Expect:3e-17, match=38/38. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits
|
| Probe Set Annotation
|
Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 A24039 7e-16 chlorophyll a/b-binding protein 1A precursor - tomato (fragments) prf||1204205A protein 1A,chlorophyll binding
|
|
Annotation via Blast
|
• BLASTX UniProt: UniRef90_P14584, Chlorophyll a-b binding of LHCII type 1 protein (Fragment) n=20 Tax=Magnoliophyta RepID=CB21_RAPSA, Expect:3e-15, match=38/38. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits
• BLASTN TIGR Plant Transcript Assemblies: BJ451134, Light harvesting chlorophyll a /b binding protein of PSII [Euglena gracilis], Expect:2e-86, match=161/161. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits
• BLASTX NCBI Reference Sequence: XP_002881334, chlorophyll A-B-binding protein 2 precursor [Arabidopsis lyrata subsp. lyrata], Expect:4e-16, match=38/38. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits
• BLASTX MSU Rice genome: LOC_Os09g17740.1, chlorophyll A-B binding protein, putative, expressed, Expect:2e-16, match=37/38. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits
• BLASTN DFCI Hordeum vulgare Gene Index: BE422434, homologue to UniRef100_P07370 Cluster: Chlorophyll a-b binding protein 1B, chloroplast precursor; n=1; Solanum lycopersicum|Rep: Chlorophyll a-b binding protein 1B, chloroplast precursor - Solanum lycopersicum (Tomato) (Lycopersicon esculentum), partial (, Expect:1e-86, match=1063/291. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits
• BLASTX Brachypodium distachyon genome: Bradi3g42620.1, , Expect:3e-17, match=38/38. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits
• BLASTX Arabidopsis thaliana genome: AT2G34420.1, | Symbols: LHB1B2, LHCB1.5 | photosystem II light harvesting complex gene B1B2 | chr2:14522716-14523513 REVERSE LENGTH=266, Expect:4e-17, match=38/38. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits
Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
|
|
Additional Annotations
|
No additional annotations found for this probe set.
|
|
Sequence
|
Total length: 330
>Barley1_00074
CTTCGTCCAGGCCATCGTCACCGGCAAGGGCCCCCTCGAGAACCTCGCCGACCACCTCGC
CGACCCCGTCAACAACAACGCCTGGGCCTTCGCCACCAACTTCGTCCCCGGCAAGTGAGC
TCAACCTCTAGCGCGCGCGCGCGCGCGCGCGCTTGGCCGACAACTTCATTGCTGATGGAT
GCTGCTGTGCTGCATGTCTTTCCGGACTGATAGATGTTGCATGTGAGGGCGAGTCGAGAT
GATGAGTTGGTGTGTGTACACTAAAAAGATGGTGTTTGTGTAATATCTGGTTATTTTTCA
GATTAACCAAGGCAAAAAAAAAAAAAAAAA
|
|
|
| | |