Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Microarray Sequence ID: Barley1_01637

Sequence ID: You may enter either an Affymetrix probe set ID or a Barley1 consensus ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
Probe sets for Barley1_01637:
Expression details for Contig1637_at
Expression details for Contig1637_s_at
  1. GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig1637_at
  2. GENE EXPRESSION VARIATION IN EXPERIMENTS for Contig1637_s_at

Alignments and Assemblies Barley1 GeneChip Assembly Barley1 GeneChip Assembly 25 contig and alignment PlantGDB PUT assemblies GrainGenes Blast HarvEST: Barley 21 Assembly HarvEST: Barley 25 Assembly HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os01g71670.1, glycosyl hydrolases family 17, putative, expressed, Expect:1e-120, match=220/332. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g60490.1, , Expect:1e-123, match=228/314. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
BEST BLASTX NR: 11/06/02 D38664 e-162 glucan endo-1,3-beta-D-glucosidase (EC 3.2.1.39) precursor - barley gb|AAA32939.1| (M62907) (1-3)-beta-glucanase [Hordeum vulgare]
Annotation via Blast BLASTX UniProt: UniRef90_P15737, Glucan endo-1,3-beta-glucosidase GII n=12 Tax=Triticeae RepID=E13B_HORVU, Expect:1e-152, match=281/334. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA28545_4513, Putative endo-1,3-beta-glucanase [Oryza sativa (japonica cultivar-group)], Expect:0, match=1084/1088. Blast executed on 2007-10-23 against TIGR TA Hordeum vulgare release 2 show top hits

BLASTX NCBI Reference Sequence: NP_001045372, Os01g0944700 [Oryza sativa Japonica Group], Expect:1e-119, match=220/332. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os01g71670.1, glycosyl hydrolases family 17, putative, expressed, Expect:1e-120, match=220/332. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Hordeum vulgare Gene Index: TC195190, UniRef100_Q8S3U1 Cluster: Beta-1,3-glucanase; n=1; Hordeum vulgare subsp. vulgare|Rep: Beta-1,3-glucanase - Hordeum vulgare var. distichum (Two-rowed barley), complete, Expect:0, match=1238/1229. Blast executed on 2010-11-03 against HvGI(DFCI) release 11 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g60490.1, , Expect:1e-123, match=228/314. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G16260.1, | Symbols: | Glycosyl hydrolase superfamily protein | chr4:9200180-9201441 REVERSE LENGTH=345, Expect:9e-62, match=141/321. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Barley1 exemplars are kindly provided by Dr. Timothy Close from HarvEST:Barley. The BLASTs in this section are based on contig assembly #25.
Additional Annotations No additional annotations found for this probe set.
Sequence Total length: 1244
>Barley1_01637
CTCTACCGCAGCATTGCATAGCATTTGAGTACCAGATACTCCATGTGTGCAGCAATGGCT
AGAAAAGATGTTGCCTCCATGTTTGCAGCTGCTCTCTTCATTGGAGCGTTCGCTGCTGTT
CCTACGAGTGTGCAGTCCATCGGCGTGTGCTACGGCGTGATCGGCAACAACCTCCCCTCC
CGGAGCGACGTGGTGCAGCTCTACAGGTCCAAGGGCATCAACGGCATGCGCATCTACTTC
GCCGACGGGCAGGCCCTCTCGGCGCTCCGCAACTCCGGCATCGGCCTCATCCTCGACATC
GGCAACGACCAGCTCGCCAACATCGCCGCCAGCACCTCCAACGCGGCCTCCTGGGTCCAG
AACAACGTGCGGCCCTACTACCCTGCCGTGAACATCAAGTACATCGCCGCCGGCAACGAG
GTGCAGGGCGGCGCCACGCAGAGCATCCTGCCGGCCATGCGCAACCTCAACGCGGCCCTC
TCCGCGGCGGGGCTCGGCGCCATCAAGGTGTCCACCTCCATCCGGTTCGACGAGGTGGCC
AACTCCTTCCCGCCCTCCGCCGGCGTGTTCAAGAACGCCTACATGACGGACGTGGCCCGG
CTCCTGGCGAGCACCGGCGCGCCGCTGCTGGCCAACGTCTACCCCTACTTCGCGTACCGT
GACAACCCCGGGAGCATCAGCCTGAACTACGCGACGTTCCAGCCGGGCACCACCGTGCGT
GACCAGAACAACGGGCTGACCTACACGTCCCTGTTCGACGCGATGGTGGACGCCGTGTAC
GCGGCGCTGGAGAAGGCCGGCGCGCCGGCGGTGAAGGTGGTGGTGTCGGAGAGCGGGTGG
CCGTCGGCGGGCGGGTTTGCGGCGTCGGCCGGCAATGCGCGGACGTACAACCAGGGGCTG
ATCAACCACGTCGGCGGGGGCACGCCCAAGAAGCGGGAGGCGCTGGAGACGTACATCTTC
GCCATGTTCAACGAGAACCAGAAGACCGGGGACGCCACGGAGAGGAGCTTCGGGCTCTTC
AACCCGGACAAGTCGCCGGCATACAACATCCAGTTCTAGTACGTGTAGCTACCTAGCTCA
CATACCTAAATAAATAAGCTGCACGTACGTACGTAATGCGGCATCCAAGTGTAACGTAGA
CACGTACATTCATCCATGGAAGAGTGCAACCAAGCATGCGTTAACTTCCTGGTGATGATA
CATCATCATGGTATGAATAAAAGATATGGAAGATGTTATGAATT
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters