Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

BradiAR1b520742 Microarray Sequence ID: Bradi1g04830.1F_at

Sequence ID: Enter a probe set ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment
No expression data available for Bradi1g04830.1F_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Bradi1g04830.1F_at

Alignments and Assemblies GBrowse at Brachybase BdGDB Browser at PlantGDB Gramene-Gene-Summary PLEXdb Blast
Model Genome Alignments None available
Probe Set Annotation By BrachyBase.org, 2011-03-11
putative protein
Lookup Bradi1g04830.1 at BrachyBase.org
Annotation via Blast
Sequence Total length: 2193
>Bradi1g04830.1F_at
ATGGCGGCGACCGCGAGGGGGAGCGCGCGGGAGATCCGGGCGGCCGACGTGGAGGTGGCC
GGGCTCGCCGCGGCCGAGGCGGGCGCCTTCCTCGCGGCTCTCCGCTCCGCCGCCGCGTCG
TCGCCGTCTTCGGACGCGGCCGAGGTGTGGGCGGCGGTGGTGGCGGCGGGTGTTCTGCGG
CCGGAGCACCCGCACGCGCTCCACCAGCTCGTCTACTACTCCGTCTACGCCGGCTGGGAC
CGCGCCGCCCGGGGCCCGCCTCCCTACTGGTTCCCGTCCCCGATTGACTGTAAGCGAACA
AATCTCGGGAGAATGATGGAACAGAATGGGCCTAAGCTGTTAGGATCATCGTACAAGGAT
CCGATTTCGAGCTTTGATCTCTTTCACAAATTCTCAGTAGAGAATCAGGAGGTGTACTGG
AGAATGGTGCTAAAGGAGCTCTCAGTCAAGTTCCTGCGCGAACCAAAGTCGATTCTAGAT
GCATCAGATAAATCAAAGAAAGGAGGAACATGGTTCCAAGGCGCTGTGCTTAACATTGCT
GAATGTTGTCTGCTACCTTGGCCTTCCCAAAATAGGACAGATGACAGCACAGCTATTGTT
TGGAGGGATGAGGGCCTTGATGATTATCCGGTGAATCGTATGTCGCTGAAGGAGCTTCGC
ACTCAAGTGATGACTGTTGCACATGCCCTTGATACCATGTTTCAAAAGGGGGACCGGATT
GCTATAGACATGCCTATGACATGCAATGCTGTCATTATTTATTTGGCAATCATCCTTGGG
GGCTTTGTTGTTGTGTCAATAGCAGACAGTTTCGCACCTCAGGAGATTGGTACACGCATG
AGAGTCTCAAACGCAAAGGCAATTTTTACTCAGGATTTCATAATTAGAGGAGGGAAGCAA
TTTCCACTTTACAGCCGTGTCATGGAAGGAACTTCATCTAAAGCTATTGTAATTCCTGCA
ACTGGAGACTGTCTTGGAGTTACACCAAGGACTGGCGATATGTCCTGGAAAGATTTTCTT
TCTCGTGCTGCTGGAAGGTCATCCATCTACTCTCCAGTTTATCAACCATCAGATGCCCTA
ATTAATATACTGTTCTCTTCAGGAACAACTGGAGAGCCAAAAGCTATACCATGGACGCAA
CTTTGTCCCATAAGATGCGGAGCTGATACCTGGGCACATTTGGATGTTCGTCCACAGGAC
ATAGGTTGCTGGCCTACAAATCTGGGTTGGGTTATGGGACCTATACTCTTGTTCTCCTGC
TTTCTAAGTGGTGCAACTTTGGCTTTGTATCATGGTTCTCCACTTGGACATGGTTTCTGC
AAGTTTGTGCAGGATGCCCGTGTTAATATGTTAGGAACTGTACCTAGCTTGGTAAAGGCA
TGGAAGGCTGGGAATCTTACTAAAGGGATAGACTGGACTAAAATCAGGGTACTTGCCACA
ACAGGGGAGGCTTCTGATATTGATGATAATCTATGGCTATCTTCACGTGCCTGTTACAAG
CCCATTGTTGAGTGCTGTGGAGGCACGGAGTTGGCATCCTCATATATTCAAGGGAGTCTT
TTGCAGCCACAAGCTTTTGGAGCTTTTAGTGGGAAATCCATGTCCACTGGGTTTGTCATA
CTTGATGAACAAGGACATCCATATCCTGATGATCAACCTTGTGCTGGAGAAGTGGGCCTC
TTCCCTTTATATTTTGGTGCTACTGATCGGCTTCTCAATGGCGACCACGATAAGGTTTAC
TTTGATGGAATGCCCATTTACAAAGGAAGGCAACTCCGACGGCACGGAGATATAATCCAG
AGGACAGTAGGTGGTTATTATATTGTACAGGGCAGAGCAGATGACACTATGAATCTTGGA
GGAATTAAGACAAGTTCGGTGGAGATCGAACGGGTTTGTAATAGAGCCGACGAGGGTCTG
CTAGAAACCGCAGCAGTTAGCATCAAACCTACCGGTGGGGGGCCTGAACAGCTGGCTATC
TTGGCAGTACTGAAAGATAGATCAGCATCATGCGATGCTCATCTTCTAAAGAGCAAGTTC
CAGCGAGCCATCCAGAAGAACCTCAATCCCCTTTTCAAGGTGAGCTACGTCAAAGTCGTT
CCCGAGTTCCCGAGAACTGCTTCAAACAAGCTGTTGAGAAGGGTTCTGAGGGATCAGCTG
AAGTTGGAACTCGTGAATCGCAGTAAGCTATGA
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters