Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Citrus Microarray Sequence ID: Cit.11118.1.S1_s_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Cit.11118.1.S1_s_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Cit.11118.1.S1_s_at

Alignments and Assemblies PlantGDB PUT assemblies HarvEST BLAST PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix, 2009-03-11
C37_14891 /DEF=Section:2 Forward ESTs:3 BEST NR:BAC10548.1 5e-90 cullin-like protein1 [Pisum sativum] /REP_ORG=Citrus
Annotation via Blast BLASTX UniProt: UniRef90_Q94AH6, Cullin-1 n=3 Tax=Arabidopsis RepID=CUL1_ARATH, Expect:4e-73, match=138/184. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA3596_309804, Cullin 1B [Nicotiana tabacum (Common tobacco)], Expect:0, match=978/978. Blast executed on 2007-11-07 against Citrus aurantium release 2, Citrus clementina release 2, Citrus clementina x Citrus tangerina release 2, Citrus macrophylla release 2, Citrus reticulata release 2, Citrus reticulata x Citrus temple release 2, Citrus sinensis release 2, Citrus sinensis x Poncirus trifoliata release 2, Citrus unshiu release 5, Citrus x paradisi release 2, Citrus x paradisi x Poncirus trifoliata release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002314453, predicted protein [Populus trichocarpa], Expect:2e-87, match=162/184. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Orange Gene Index: TC5350, homologue to UniRef100_A7NW32 Cluster: Chromosome chr5 scaffold_2, whole genome shotgun sequence; n=1; Vitis vinifera|Rep: Chromosome chr5 scaffold_2, whole genome shotgun sequence - Vitis vinifera (Grape), partial (26%), Expect:0, match=995/952. Blast executed on 2009-09-13 against Orange 1.0 show top hits

BLASTX Arabidopsis thaliana genome: AT4G02570.4, | Symbols: CUL1 | cullin 1 | chr4:1129315-1133435 FORWARD LENGTH=739, Expect:7e-75, match=138/184. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 978
>Cit.11118.1.S1_s_at --
ggtacttgtaacctccttggcaaatttgaatcaagaactacagagttgattgtcacaacc
tatcaggcttctgcgttgcttttattcaattcctcagataggctgagttattcagagatc
atgacgcagttgaacttgtccgacgatgatgttgttagattgcttcattccttgtcatgt
gcaaaatataagattctcaacaaagagccaaatacaaaaaccatctctcctactgatcac
tttgagttcaattccaagtttacggacaaaatgaggagaatcaagattcctctccctcct
gtggatgagaaaaagaaggttattgaagatgttgataaggacagacgatatgccattgat
gcctcaattgtgcgcattatgaaaagtcggaaagttttggggcaccaacaattggtattg
gagtgtgtcgagcagttgggccgcatgttcaagcctgatttcaaggcaatcaaaaagagg
attgaggatcttatcactcgagactatctcgagagggacaaatctaatcccaatatgttc
aggtacttggcgtgatctagagtggttggtaatccagatgaagtgttgacatttgctgcc
cacaaagagggttagttcatggtggaactgggacaaacatatgtaaaccgccgccaggag
tgccttatctggtgattgctcagaagcagagctgtgatgcttgtacattttgctgttgcg
ccaggtgtgaggagcaggtatagatttcaaacccatgttggagaaatagttattcattcc
ttaatgtggttcagtgcaccgagagacaatgctgttctgtcttcttatttctgcaatccc
atttcgtgaattgatgtttgtttgtgatttctctttcttttataatttcttttgctgaag
aaatatgtatcttaaatctatcaaagtggtgttttgattgtaagtttataagagattgcc
tggtgaaatatctctata
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters