Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Cotton Gossypium hirsutum Sequence ID: Ghi.5139.1.S1_x_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Ghi.5139.1.S1_x_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Ghi.5139.1.S1_x_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:DQ174250.1 /DB_XREF=gi:74486727 /GEN=EF1A1 /TID=Ghi.5139.1 /CNT=116 /FEA=FLmRNA /TIER=FL+Stack /STK=15 /UG=Ghi.5139 /DEF=Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA, complete cds. /PROD=translation elongation factor 1A-1 /FL=gb:DQ174253.1 gb:DQ174250.1 /REP_ORG=G. hirsutum
Annotation via Blast BLASTX UniProt: UniRef90_O64937, Elongation factor 1-alpha n=206 Tax=Eukaryota RepID=EF1A_ORYSJ, Expect:0, match=318/322. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA20437_3635, gb|DQ174250.1; /DEF=Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA, complete cds. /GEN=EF1A1 /PROD=translation elongation factor 1A-1, Expect:0, match=2134/0. Blast executed on 2008-04-07 show top hits

BLASTX NCBI Reference Sequence: NP_001049145, Os03g0177400 [Oryza sativa (japonica cultivar-group)], Expect:0, match=447/345. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX Arabidopsis thaliana genome: AT5G60390.3, | Symbols: | elongation factor 1-alpha / EF-1-alpha | chr5:24289226-24290675 FORWARD, Expect:0, match=449/340. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1777
>Ghi.5139.1.S1_x_at gb|DQ174250.1; /DEF=Gossypium hirsutum translation elongation factor 1A-1 (EF1A1) mRNA, complete cds. /GEN=EF1A1 /PROD=translation elongation factor 1A-1
cgcgttaaactatgatcccnngnnnnnnnncnnnnncncaacgctctcnnntnctgnttc
tggtcaagccaatctcaaaagactccccttttagctcacagctcctctcttgagtactat
aatgggtaaggagaaggttcacatcaacattgtggtcattggccatgtcgactctgggaa
gtctacaaccactggtcatttgatctacaagcttggtggtattgacaagcgtgtgattga
gaggtttgagaaggaggctgctgagatgaacaaaaggtcatttaagtatgcatgggtgct
tgacaagcttaaggccgagcgtgaacgtggtattaccatcgatattgccctctggaagtt
tgagactaccaaatactactgtactgtcattgatgcccctggacatcgtgacttcatcaa
gaacatgattactggtacctcacaggctgactgcgctgttctcattatcgactcgaccac
tggtggtttcgaagctggtatctcaaaggatggtcagacacgtgagcatgctttgcttgc
gtttacccttggtgtcaagcagatgatttgctgctgcaacaagatggatgcaacaactcc
aaaatactccaaggcaaggtatgatgaaattgtgaaggaagtctcctcatatcttaagaa
agttggttacaaccctgacaagatcccatttgtcccaatctctggatttgagggtgataa
catgattgagaggtctaccaaccttgactggtacaagggtcccactctccttgaggctct
tgaccagatcaatgagcccaagaggccttcagacaagccgctccggctcccacttcagga
tgtctacaagattggcggcattggaactgtgcctgttggtcgtgttgagactggtgtnct
taagcctggtatggtagtgacctttggcccctctggnctgaccactgaagttaagtctgt
tgagatgcaccatgaagccctctctgaggctctccctggtgacaatgttggattcaangt
caagaacgttgctgttaaggatctcaagcgtggtttcgttgcttcaaactctaaggatga
tcctgcanaaggaggctgccagcttcacctctcaggtcatcatcatgaaccaccctgggc
agattggaaacggatatgccccagtccttgactgccatacctcccacattgctgtgaant
tttcngaattgctgaccaagatcgacaggcgatctggaaaggagcttgagaaggagccca
agttcttgaagaatggtgatngcagggatgataaagatggttcccaccaagcctatggtt
gtggagactttctctgagtacccacccncttggacggtttgctgtcagggacatgcgtca
gactgtggctgttggtgtcatcaagagcgttgagaagaagganccaacnggtgctaaggt
caccaaatctgctgccaagaagaaatgagattgcatttgatagtatcanagccttttgat
tttggttntctntgtagtntggtacttnacagttttttagaccaattttgatantgtgtt
catttggttgagactgncatctgcnnacggattgtgtgtttgctttttccgtgtcaattn
tagttgaattccttcaaagaatgctantttngatatttccnttgtttnnnnannnnnann
annnnnnnaagccttcgattttcaactaattttcgtggtccaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters