Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Cotton Gossypium raimondii Sequence ID: Gra.1899.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Gra.1899.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Gra.1899.1.S1_at

Alignments and Assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:AM048818.1 /DB_XREF=gi:70663491 /GEN=stv1 /TID=Gra.1899.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /UG=Gra.1899 /DEF=Gossypium raimondii mRNA for sialyltransferase-like protein (stv1 gene). /PROD=sialyltransferase-like protein /REP_ORG=G. raimondii
Annotation via Blast BLASTX UniProt: UniRef90_P70277, Alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 n=3 Tax=Murinae RepID=SIA7B_MOUSE, Expect:1e-12, match=68/223. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA13162_29730, gb|AM048818.1;, Expect:0, match=1713/0. Blast executed on 2008-04-07 show top hits

BLASTX NCBI Reference Sequence: XP_002306228, predicted protein [Populus trichocarpa], Expect:1e-164, match=390/270. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX Arabidopsis thaliana genome: AT1G08280.1, | Symbols: | glycosyl transferase family 29 protein / sialyltransferase family protein | chr1:2608408-2609604 FORWARD, Expect:1e-123, match=398/220. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1737
>Gra.1899.1.S1_at gb|AM048818.1;
tttaatgcttgttgcattagctgcaacactattctgtcggattgccatccgcgggggcag
cggtggtggatttgctgtttcagctgaattggagaccaccaggtccagggtcctaatcca
acccccaccaatccaaaattttaactcaactttgctcaagtttgcagcggttgatacagg
tgaagctaaatccaagcttgaaatagagcagctgctggaagggagctttgcgggtcaagg
aaggtataggacttttgcaacatggaggaggttcaatcatcatgatgtcaaagctaggaa
ttctaatgggatgccggtaatgctcaggtcccctaaattttatcggtattggttagattt
taggaggaacttacagcattgggctagaaaaagaatgttccaacctgatattatgatgga
tttagttacactagtaaaggttcctattgatagccataatggtttaatgagttcggataa
caagtataaatcttgtgctgttgtggggaatagtgggattttactgaatactgatcatgg
gaagttcattgatggtcatgaggccgtgattagattgaacaatgctaggactgagaggtt
cgaaaagaatgtggggtcgaaaaccagtatttcgtttgtaaatagcaatatactgcatct
ttgtgctaggagggatggatgtttttgtcacccttatggagggaatgttcctatggttat
gtatatctgccaaccggttcatttcatggactatttggtatgcaattcgtctcacaaggc
acctttgttgattacagatctgcgttttgatatgttgtgtgctaggattgtgaagtacta
ttcagcgaaacgatttttggaggagaccaggaaggcattgagagaatgggcttctacaca
tgatggttcgatgtttcattactcctctgggatgcaggctgttatgttagccttgggaat
ttgtgacaaagttagtatatttggctttggcaaatcgactttggcgaagcaccattatca
tactaaccagaaggctgagctccgtttacatgattatgaggcggaatatgcattttatca
tgatctggtgaagaatccacgggcaataccattcatttcggacaaattcaggttccctcc
tgtggtattctatcaatgattttggctgattggtttcttttttaattttattttgtcctt
gttttgttggtcaagactaaatcagtgtgttccatggtgtatcagtaattctgtagtgga
tagtcaaaagaaaacacaaatgctgaagatctgtgtttcatattctggacctgcactgtc
gaagatggtttagggtaataggaaatgtaaaattggaaactaagaatatgaagtaagata
tggtggattcttcatatgctttttgttgagcttttgagatgttgttctttctggtgcaat
gtttggggattcaagagtaagtccctttaaggtattgtaagcctctagaaattcaaactc
attcatctagcttatagatcaattagtatttgttttgctgtgtgtattcggatttgggtt
ctgaattagtgggttgggtcctctttagacaaatgggtccaacaaggggctgccttagac
accttcattaattgtgtactacatgcatatcatgaataacgtggtcatacattattctac
taaaaggggaatatgattgttatgatttgtgctaaaaaaaacttaaaagaaaaaaaa
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters