Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Fusarium Microarray Sequence ID: fg12315_at

Sequence ID: You may enter either an Affymetrix probe set ID or a consensus ID
Probe Set Details Probeset-level information from MIPS

EXPRESSION DETAILS for fg12315_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for fg12315_at

Alignments and Assemblies FGDB MIPS Fusarium database PLEXdb Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2005-12-12
related to C.elegans dom-3 protein, Contig fg_contig_1.305 35749-34155
Annotation via Blast BLASTX UniProt: UniRef90_UPI000023D825, hypothetical protein FG07345.1 n=1 Tax=Gibberella zeae PH-1 RepID=UPI000023D825, Expect:0, match=354/368. Blast executed on 2009-07-02 against Uniref90 (July '09) show top hits

BLASTN DFCI Fusarium verticillioides Gene Index: DR656173, similar to UniRef100_Q4I613 Cluster: Protein RAI1; n=2; Gibberella zeae|Rep: Protein RAI1 - Gibberella zeae (Fusarium graminearum), partial (13%), Expect:3e-15, match=151/112. Blast executed on 2009-09-23 against FvGI release 8.0(2008/07/01) show top hits

Sequence Total length: 1107
>fg12315 related to C.elegans dom-3 protein, Contig fg_contig_1.305 35749-34155
ATGGCGGCGCGCTTTTCTATTCAACCCATTGGCCGATTTGCTGGTGAAAGCCAACCTGTC
AAAAGACCCAAGGAGTTTGCATGCTTCTCCTATGACGACAACCACGAGTTTCGTCTTGAT
GGCTCTTCTCTCAAGTACTATTACACCCCACAGCTAGGGGCAGACCTCTCCAAGGGATTT
GATACTTTTCAGAAGCTGGATGATACTGGAGATGATCATCTCGATAGCCTTCTCAAGACA
ATCGTTGCTCATGAGCAAGAGACTGGTAAAAAGATAGATGCCAATGTCGTCACCTGGAGA
GGCATGATGACCAAGATTATGGCTACCCCCTTTGATAATATGGATGGTTTCGAGATGAAT
GCTACACTATATCAAAACAACGCCTACAAGGTCGCCTCCAGGTCCAATGAGGGTAACAAC
AACAGGCGCAGAAGAGGGCCACCACTAGAAGTCATGCAGTTCTGGGGGTACAAGTTCGAA
ACCCTATCGACCCTGCCAGCACCATGGGCAGAAACCCCGCGCGAGTTTATCGAAAACCGA
GAGAATGAAGTTGTCAACAACAAAGCCCAGTACTGTTCTGTCGTCCGAACAGGTATTGGT
AAATCTGTTCTTTGCCTCGGCGGTGAAGTCGACGCCATCTGGGACTCCAAGCCTGAAGAA
AAGGGCAGTCCTATCAACTGGGTAGAGCTCAAGACATCCGCCGAGATTCGCAATACGGGA
GATATGGAGAACTTCAACCGTAAGCTGATGAAATACTGGATTCAGTCGTTTCTTCTTGGA
GTGCCGCGCATTGTTGTTGGGTTTCGCACGCGAGACGGCATTCTGGTTGAGGCAAAGGAC
ATTGAGACGCATCGCATTCCCGAGACAGTCAACTCTTATCCGAACCCCAAATGGAACGCT
GATATGTGCGTCAACTTCGCCGCCACTTTCCTAGACTGGCTATCCGCGAACATCACCGAT
GAGGGCGTTTGGAGAATAAAGCGTGAACCTCAGTCGCCCACCATTGAGCTTTTCAAGGTA
GAAGAGACAGGACACGGTGATATCCTGTCCGATGAGTTCAAGAATTGGAGAATCAAGCTG
GCTCTCGGGCCTAGCAACGAAAGCTGA
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters