Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Gossypium hirsutum
Gossypium raimondii
Experiments
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Grape Vitis vinifera 16k Microarray Sequence ID: 1607001_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for 1607001_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for 1607001_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments Grape Genome Browser (Gramene): GSVIVG00014415001, pep:novel chromosome:8X:18:12194290:12198185:-1 gene: transcript:GSVIVT00014415001, Expect:0, match=448/417. Blast executed on 2009-01-08 against Vitis Vinifera 8X assembly, Dec 2007 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:CF404264 /DB_XREF=gi:34362679 /DB_XREF=CSECS024B06_PREu0032 /CLONE=CSECS024B06 /TID=Vvi.304.1 /CNT=30 /FEA=EST /TIER=Stack /STK=6 /UG=Vvi.304 /UG_TITLE=Vitis vinifera transcribed sequence with strong similarity to protein sp:P12411 (A.thaliana) TBB1_ARATH Tubulin beta-1 chain /REP_ORG=V. vinifera
Annotation via Blast BLASTX UniProt: UniRef90_Q41783, Tubulin beta-6 chain n=8 Tax=Eukaryota RepID=TBB6_MAIZE, Expect:0, match=395/434. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA37285_29760, Tubulin beta-6 chain [Gossypium hirsutum (Upland cotton)], Expect:0, match=1615/1615. Blast executed on 2007-10-23 against TIGR TA Vitis vinifera release 5 show top hits

BLASTX NCBI Reference Sequence: XP_002275306, PREDICTED: hypothetical protein [Vitis vinifera], Expect:0, match=417/434. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Vitis vinifera Gene Index: TC110710, UniRef100_A7NSU9 Cluster: Chromosome chr18 scaffold_1, whole genome shotgun sequence; n=1; Vitis vinifera|Rep: Chromosome chr18 scaffold_1, whole genome shotgun sequence - Vitis vinifera (Grape), partial (83%), Expect:0, match=1430/1212. Blast executed on 2010-11-03 BLAST executed 10/25/10 against VvGI(DFCI) release 7 show top hits

BLASTX Arabidopsis thaliana genome: AT1G75780.1, | Symbols: TUB1 | tubulin beta-1 chain | chr1:28451378-28453602 REVERSE LENGTH=448, Expect:0, match=407/434. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Additional Annotations From Grant Cramer, University of Nevada, Reno, NV
UniProt: (Q6VAF6) Tubulin beta-6 chain (Beta-6 tubulin)
MIPS: 42.04.05 microtubule cytoskeleton
Annotation: homologue to UP|TBB1_ARATH (P12411) Tubulin beta-1 chain (Beta-1 tubulin), complete
Sequence Total length: 1681
>1607001_at gb|CF404264; /DB_XREF=CSECS024B06_PREu0032 /CLONE=CSECS024B06
cccgcgaactcctccnnaaccaccatcaccaccaccactcaatttttggttttcgttttc
attttcattctcnccaaacacaaaaacgatgagggagatcttgcacgttcagggaggcca
atgcggtaaccaaattggatccaagttctgggaggtcatctgcgacgagcacggtgtgga
tcccactgggaggtacaacggagatggttcatctgatcttcagttggagaggatcaatgt
ctactacaatgaggcttctggtggaaggtacgttcccagggctgttctcanggatcttga
gcctgggactatggacagtatcagatcgggaccgtatgggcagatctttcgccctgataa
tttcgtttttggtcagtccggtgccggcaacaattgggccaagggtcattatactgaggg
ggcggagttgattgatgcggttctcgatgttgttcgcaaggaggctgagaattgtgattg
catgcaaggttttcaagtgtgccactcacttggaggaggcactggttctggcatggggac
cctcctgatatcaaagatgagagaggaatacccagatagaatgatgctcactttctccgt
cttcccatctncnaaggtctctgacacagttgtggagccatataatgccaccctctcggt
gcaccagttggtngngaatgctgacgaatgcatggttctggacaatgaggctctttatga
tatttgtttcaggactctcaagctcagcactcctagctttggtgacctgaaccacttgat
ctctgcgacnatgagtggggtgacttgctgcctgaggttccctggccagctgaactcaga
cctccgcaagctggctgtgaatctgatcccgttccctcgccttcatttctttatggtggg
ttttgcaccactcacctctcgtggatcccagcagtacatctccctcacagtgccagagct
aactcagcaaatgtgggatgccaagaacatgatgtgtgcggctgaccctcggcatggccg
ctacctgactgcctcggccatgttcaggggaaagatgagcaccaaggaggtggacgaaca
gatgatcaatgtgcaaaacaaaaactcgtcatattttgtggagtggattcctaataacgt
gaaatctagtgtgtgcgatattccaccaagaggtctgaagatggcatctacatttgtggg
gaactccacttcaatccaggagatgttcaggagggtgagcgagcagttcacagccatgtt
caggcgcaaggctttcttgcactggtatactggggaaggaatggatgagatggaattcac
ggaagcagagagcaacatgaatgatttggtgtcagaataccagcaataccaggatgcaac
tgctgatgacgagggtgagtatgaggagggcccagaagagaattatgaggcctaaaagcc
ttaaagcctaaataagattttgggagatgagcacctaagctttgcccatttatctgctac
tactatatgtggctgttanagtttcagatttatttccattttgcttgcagcttgtttgta
tcgtcacctggtttgaatcttctcttccataatataatgtttgtgggttgtgttcnannn
aaaaaaaaaaaaaannannnnnnaaannnnnnaaaaaaaaaaaaaaaaaaaaannnnnaa
a
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters