Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

GrapeGena520510F (Custom Affymetrix Grape Array) Microarray Sequence ID: VVTU6040_x_at

Sequence ID: Enter a probe set ID
Sequence Type mRNA
Probe Set Details Probe Sequences & Alignment
No expression data available for VVTU6040_x_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for VVTU6040_x_at

Alignments and Assemblies
Model Genome Alignments None available
Probe Set Annotation NCBI GEO (GPL11004-11999.txt downloaded from GEO), 2012-03-21
X75967 V.vinifera PAL mRNA for phenylalanine ammonia lyase.
Annotation via Blast
Additional Annotations Annotation provided by Jeremy Grimplet (Grimplet J. et al. 2012. BMC Research Notes).
VVTU6040_x_at; Locus name (if assigned):
No hit
Sequence Total length: 194
>VVTU6040_x_at X75967 V.vinifera PAL mRNA for phenylalanine ammonia lyase.
TGTAAAACTTGAGATTGTCTGCCCCCCTTCAATTTTTTGATACAAAAATTGTTAGCTATA
TGGAAGCTCTGATAGCAATTTGTTGGAGCAATTGGATTGTTGTAATTAAAAATATTTACA
ATTTGAACTCTTATACCAATATTTTGGAATAATGGGATTGTAGTAAAAATATCAATAGTT
TGCCCTTGAGGTTT
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters