Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 100 format Whole Transcriptome Microarray Sequence ID: S2-ZM_BFb0031C03_x_st

Sequence ID: Enter a probe set ID
Sequence Type CDS
Probe Set Details Probe Sequences & Alignment
No expression data available for S2-ZM_BFb0031C03_x_st
Alignments and Assemblies GrainGenes Blast PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os08g05830.1, transaldolase, putative, expressed, Expect:1e-180, match=330/399. Blast executed on 2010-11-03 against Rice genome, MSU release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi3g16930.1, , Expect:1e-163, match=282/339. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Roger Wise Lab, 2010-10-27
S2
Annotation via Blast BLASTX UniProt: UniRef90_C5YGY0, Putative uncharacterized protein Sb07g003600 n=2 Tax=Andropogoneae RepID=C5YGY0_SORBI, Expect:0, match=358/394. Blast executed on 2011-01-04 against Uniref90 (Nov '10) show top hits

BLASTX NCBI Reference Sequence: NP_001131550, hypothetical protein LOC100192890 [Zea mays], Expect:0, match=374/394. Blast executed on 2010-12-12 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os08g05830.1, transaldolase, putative, expressed, Expect:1e-180, match=330/399. Blast executed on 2010-11-03 against Rice genome, MSU release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC550429, , Expect:0, match=1763/1485. Blast executed on 2010-11-03 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi3g16930.1, , Expect:1e-163, match=282/339. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT1G12230.1, | Symbols: | Aldolase superfamily protein | chr1:4148050-4150708 FORWARD LENGTH=406, Expect:1e-136, match=255/406. Blast executed on 2010-11-03 against Arabidopsis thaliana genome, TAIR pre-release 10 show top hits

Sequence Total length: 1485
>S2-ZM_BFb0031C03_x_st
CCCAACTGCCATGGCGCTCTCCATCTACACGCCCACCTCCTCCTCCCTCGTCCCGCCCTC
CATTCAGGAGGTCAGGCTGACTTCGCGACCGCCAAAGCCCGCGACTTTCAGCCTACGGAG
GCCACATCTGGCCGCGCGGGCCGCCGCTGGCAACGCACCCACGTCCCCGGTCCGCGAGGT
CGTCACTGAGCTCGACGCGGTCGCCGGCTTCAGCGAGATCGTGCCGGACACCGTCGTGTT
CGATGATTTCGAGAGGTTCGCACCCACGGCGGCCACAGTGAGCTCGTCGCTGCTGCTTGG
GATCACTGGGCTCCCAGACACTAAGTTCAAGAGTGCGATAGATACTGCACTGGCAGATGG
TGAGTGCAACGCACTGGAGAAGGCTGAGGACAGGATGTCCTGTTACCTCACCAAGGCTCT
TGCAAATGTTGGCGCTGAACTGGCTCATCAAGTCCCTGGGAGAGTTTCGACGGAAATAGA
TGCTCGGTTAGCTTATGACACCCAGGGCATAATCCACAGGGTACATGAACTGTTGAATCT
ATACAACCAACATGATGTCTCAACTGACCGCCTGTTATTCAAAATTCCTGCTACATGGCA
AGGCATAGAGGCCTCAAGGTTGCTTGAATCTGAAGGAATTCAAACGCATCTAACATTTGT
TTACAGTTTCGCACAAGCGGCAGCGGCAGCACAAGCTGGTGCATCTGTAGTACAAATGTT
TGTGGGCCGATTGCGGGACTGGGCAAGGCATCACTCTGGTGACCCAGAGATAGATGAAGC
TTTGAAGAATGGAGAAGATGCTGGGCTTTCTTTGGCGAAGAAAGTATATGCCTATATTCA
CAGGAATGGGTACAAAACAAAGCTGATGGCCGCTGCCATACGGAACAAGCAGGACGTATT
TAGCCTTCTGGGGATCGATTACATCATTGCACCACTGAAGATATTGCAGTCTCTGGAAGA
ATCTGTCACCGATCCCGATGTGAAGTACGGCTATGTCCCGAAGTTGACTCCTGCTATTGG
CAAGACGTACAACTTCACTGAAGAGGAGCTTGTGAAGTGGGACCAGCTGAGCCTGTCAGC
TGCCATGGGACCAGCTGCAGAAGAACTGCTTGCTTCAGGGCTAGAGGGGTACGTGAACCA
AGCACGCCGCGTTGAGGAGCTCTTTGGGAAGATCTGGCCACCTCCCAATGTTTAACAACG
GCGTTGAGAGCAATAGCAATGTGATTTGCCTGGCAGGCTCACAATGCTGCGCGGAAGACG
ATTTGCTTCTTTTTGGATAATACACGAAGCACTCCCGTGTTTACGTTGACTTGACTTGCA
GTGTGCATGTATTCTGTTTTTGTTTGTAATTCAGATGATTTGCTGGATCCATGAGAACCT
GTCGCCTGATATTCCCTGCAACTGCAATCGTCCTCGTACGTACGGCTGGCAACGGCTTCT
TGGAACATCACCACCTGAGCTGCAGTTACATGATTCCATTTATAC
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters