Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize100WT_for_maize(Maize-100-format-Whole-Transcript Array for maize) Microarray Sequence ID: S2-ZM_BFb0031C03

Sequence ID: Enter a probe set ID
Probe Set Details Probe Sequences & Alignment
MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V2; in progress)
No expression data available for S2-ZM_BFb0031C03
GENE EXPRESSION VARIATION IN EXPERIMENTS for S2-ZM_BFb0031C03

Alignments and Assemblies
Model Genome Alignments None available
Probe Set Annotation PLEXdb, 2010-10-27
UniRef90_B9N3Q0:Predicted protein n=1 Tax=Populus trichocarpa RepID=B9N3Q0_POPTR:% idty 90.9
Microarray platform information
Annotation via Blast BLASTX UniProt: UniRef90_Q65PZ8, Transaldolase n=1 Tax=Mannheimia succiniciproducens MBEL55E RepID=TAL_MANSM, Expect:4e-40, match=102/328. Blast executed on 2012-11-05 against uniref90_rel2011_12 show top hits

BLASTX NCBI Reference Sequence: NP_001131550, hypothetical protein LOC100192890 [Zea mays], Expect:0, match=374/394. Blast executed on 2012-11-26 against NCBI RefSeq rel-44 show top hits

Additional Annotations none
Sequence Total length: 1485
>S2-ZM_BFb0031C03 UniRef90_B9N3Q0:Predicted protein n=1 Tax=Populus trichocarpa RepID=B9N3Q0_POPTR:% idty 90.9
CCCAACTGCCATGGCGCTCTCCATCTACACGCCCACCTCCTCCTCCCTCGTCCCGCCCTC
CATTCAGGAGGTCAGGCTGACTTCGCGACCGCCAAAGCCCGCGACTTTCAGCCTACGGAG
GCCACATCTGGCCGCGCGGGCCGCCGCTGGCAACGCACCCACGTCCCCGGTCCGCGAGGT
CGTCACTGAGCTCGACGCGGTCGCCGGCTTCAGCGAGATCGTGCCGGACACCGTCGTGTT
CGATGATTTCGAGAGGTTCGCACCCACGGCGGCCACAGTGAGCTCGTCGCTGCTGCTTGG
GATCACTGGGCTCCCAGACACTAAGTTCAAGAGTGCGATAGATACTGCACTGGCAGATGG
TGAGTGCAACGCACTGGAGAAGGCTGAGGACAGGATGTCCTGTTACCTCACCAAGGCTCT
TGCAAATGTTGGCGCTGAACTGGCTCATCAAGTCCCTGGGAGAGTTTCGACGGAAATAGA
TGCTCGGTTAGCTTATGACACCCAGGGCATAATCCACAGGGTACATGAACTGTTGAATCT
ATACAACCAACATGATGTCTCAACTGACCGCCTGTTATTCAAAATTCCTGCTACATGGCA
AGGCATAGAGGCCTCAAGGTTGCTTGAATCTGAAGGAATTCAAACGCATCTAACATTTGT
TTACAGTTTCGCACAAGCGGCAGCGGCAGCACAAGCTGGTGCATCTGTAGTACAAATGTT
TGTGGGCCGATTGCGGGACTGGGCAAGGCATCACTCTGGTGACCCAGAGATAGATGAAGC
TTTGAAGAATGGAGAAGATGCTGGGCTTTCTTTGGCGAAGAAAGTATATGCCTATATTCA
CAGGAATGGGTACAAAACAAAGCTGATGGCCGCTGCCATACGGAACAAGCAGGACGTATT
TAGCCTTCTGGGGATCGATTACATCATTGCACCACTGAAGATATTGCAGTCTCTGGAAGA
ATCTGTCACCGATCCCGATGTGAAGTACGGCTATGTCCCGAAGTTGACTCCTGCTATTGG
CAAGACGTACAACTTCACTGAAGAGGAGCTTGTGAAGTGGGACCAGCTGAGCCTGTCAGC
TGCCATGGGACCAGCTGCAGAAGAACTGCTTGCTTCAGGGCTAGAGGGGTACGTGAACCA
AGCACGCCGCGTTGAGGAGCTCTTTGGGAAGATCTGGCCACCTCCCAATGTTTAACAACG
GCGTTGAGAGCAATAGCAATGTGATTTGCCTGGCAGGCTCACAATGCTGCGCGGAAGACG
ATTTGCTTCTTTTTGGATAATACACGAAGCACTCCCGTGTTTACGTTGACTTGACTTGCA
GTGTGCATGTATTCTGTTTTTGTTTGTAATTCAGATGATTTGCTGGATCCATGAGAACCT
GTCGCCTGATATTCCCTGCAACTGCAATCGTCCTCGTACGTACGGCTGGCAACGGCTTCT
TGGAACATCACCACCTGAGCTGCAGTTACATGATTCCATTTATAC
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters