Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Microarray Sequence ID: Zm.10134.1.A1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment
MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V2)

EXPRESSION DETAILS for Zm.10134.1.A1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Zm.10134.1.A1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os03g39850.1, glutathione S-transferase, putative, expressed, Expect:2e-70, match=130/227. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g60760.1, , Expect:2e-68, match=129/226. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:BQ619055 /DB_XREF=gi:21621049 /DB_XREF=RNOSEQ3C02_SK.ab1 /CLONE=RNOSEQ3C02_SK.ab1 /TID=Zm.10134.1 /CNT=9 /FEA=EST /TIER=ConsEnd /STK=0 /UG=Zm.10134 /UG_TITLE=Transcribed sequence with weak similarity to protein ref:NP_187538.1 (A.thaliana) putative glutathione transferase (Arabidopsis thaliana) /REP_ORG=Z. mays
Annotation via Blast BLASTX UniProt: UniRef90_Q03662, Probable glutathione S-transferase n=1 Tax=Nicotiana tabacum RepID=GSTX1_TOBAC, Expect:9e-49, match=100/219. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA173932_4577, , Expect:0, match=768/768. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: NP_001147759, glutathione S-transferase [Zea mays], Expect:1e-115, match=204/227. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os03g39850.1, glutathione S-transferase, putative, expressed, Expect:2e-70, match=130/227. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC495079, , Expect:0, match=864/753. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g60760.1, , Expect:2e-68, match=129/226. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT3G09270.1, | Symbols: ATGSTU8, GSTU8 | glutathione S-transferase TAU 8 | chr3:2848407-2849226 REVERSE LENGTH=225, Expect:1e-43, match=89/206. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 881
>Zm.10134.1.A1_at gb|BQ619055
cccgggctgcaggaattcggcannngaagaaacntgtcttcttcacctgttaagatcatc
ggccattcggtaagcccattctcgcaccgcgtcgaggccgctctgcggctcaagggcgtg
ccgtatgagctgatccaggaagacctgagcaacaagagcgagctgctgctcgccaaaaan
cctgtccacaagaaggtgcccgtgctcctccatgccgatcgtgccatctgtgagtccctc
gtcatcgtcgagtacgtcgacgagacnttcgacgggccgtccctcctcccggccgacccc
cacgaccgtgccacggcccgtttctgggcagacttcatggacaggaagctccngaagccg
ttctggctggcgcactggacagagggcgacgcgcagaaggctcaggtggaagaggccaag
cagaagctggcgctcatggaggcgcagctcgacgggaggaggttcttcgggggcgacacc
gtcggctacgtcgacatcgcagcctgcgtgctagctccttggctcagcgtcgtagaggag
gtgactggagtggccgtggttgacgaaggtgagttccctgctctgcgccgttggtccaga
gagtacagctcctgcgaagctctcaagcagtgcgtcccggacagggaccagctcgtcgcc
ttctatactgaaaggaaggaggcgtacaaagtgttcgctaatgcatggttgcagcagtag
tttggttttgtgtgtggaataataatgtatggatcacagattgtctgtgctgaaataaca
gtaatgagcctagnnananaannaaannnnnaaaaannnnnnnnnnnnnggnnnnctacc
aatttccccagtaaaatnntntttaaggngggggcgcccnc
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters