Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Microarray Sequence ID: Zm.19219.1.A1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment
MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V2)

EXPRESSION DETAILS for Zm.19219.1.A1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Zm.19219.1.A1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os03g45400.1, antitermination NusB domain-containing protein, putative, expressed, Expect:1e-104, match=186/213. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi1g13230.1, , Expect:4e-89, match=160/192. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:CO517800 /DB_XREF=gi:50322674 /DB_XREF=3530_1_115_1_G11.x_1 /TID=Zm.19219.1 /CNT=23 /FEA=mRNA /TIER=ConsEnd /STK=0 /UG=Zm.19219 /UG_TITLE=PCO070149 mRNA sequence /REP_ORG=Z. mays
Annotation via Blast BLASTX UniProt: UniRef90_Q8RAD1, N utilization substance protein B homolog n=1 Tax=Thermoanaerobacter tengcongensis MB4 RepID=NUSB_THETN, Expect:2e-06, match=37/112. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA182270_4577, , Expect:0, match=1116/1116. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: NP_001150841, LOC100284474 [Zea mays], Expect:1e-122, match=227/280. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os03g45400.1, antitermination NusB domain-containing protein, putative, expressed, Expect:1e-104, match=186/213. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC534535, , Expect:0, match=1293/1089. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi1g13230.1, , Expect:4e-89, match=160/192. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G26370.1, | Symbols: | antitermination NusB domain-containing protein | chr4:13334099-13336153 REVERSE LENGTH=302, Expect:2e-70, match=127/197. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1360
>Zm.19219.1.A1_at gb|CO517800
cgctgnccgctctccnctcctccggtccttccgccggcgggcacgcgccgggcgaaatgg
aagcggcaccatccctccgcaccttctccccctcatcgttcttctccgcggggcctagac
actgccttctgctcgcgggcccggcctcgcggcgcgcccgggcgctcccggcgccgcccc
tgccccgcgccgtcgcctccaccngcgcgccgctggtggtctccagcccgccaccgcccg
cggcctcggggacgaccgcacccgcgcacgccaaggttgaccgctccggccgcttctgca
gccctcgcgccgcccgggagctagcgctgatgatttcctacgccgcgtgtctggagggaa
ccgacgtcgttcggctcttcgaccgcaggatcagcgcaagacgagagcccgggtttgttt
tcgacaaggcatgcctactgagttacaaccatatgagctttggcgggggaccgctcgagg
ttggaacggaggaggaggctgagaagctgaccagtcagaacgagaaggattcagccaacg
aagcagatgtactttcagctcctccaaaactggtttacaacaactttgtcttacggttgt
ccagggaacttttagtggctgttgccagtggatgggataagcatgtagagatcatcgaca
aaataatcccccangcttggaaggatgagcctgtggcaaggatactcgagctctgcattc
tacatattgctatggcagagatgacatcaaaaggaacacctcacaaagttgtgattaatg
aggcagtagatntggcaaagcgattttgtgatggtggtgcccctcgggtaatcaatggat
gccttcgaacatttgtaaaggatcatgttgacgttgcaggcactagcnagggagctgaat
caaaattgtgaacctttgcaaataccctgaatcgtacaacagaatggtggctgangtaaa
gaactatgtagaaaacatngctgtcttggagttccagcaaccacattccatcntgaagat
ttagcgtttaacctaagggaacctaaacaacaaacatgctgggctcatcaaggagccnca
gatagttcattctttcagagtgatcggttattgggtgaagtatacagggctgtaaactgg
tggtgcacatccatcctccatctgaaacaactgagggttatcgcttctgataacccncag
atcgttaaatgatcagataaagatcacaagttctgtaaaagcttgatgtatatgtaaaat
gttctgcttatcataggcttattgcactgggagctggataattctagtttaataaattaa
tgcgagactnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters