Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Wheat 61K
Experiments
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Microarray Sequence ID: ZmAffx.15.1.A1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment
MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V2)

EXPRESSION DETAILS for ZmAffx.15.1.A1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for ZmAffx.15.1.A1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): No hits

Brachypodium distachyon Alignment at Brachybase: No hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:AI491598 /DB_XREF=gi:4646431 /DB_XREF=486019C07.x4 /TID=ZmAffx.15.1 /CNT=1 /FEA=EST /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /REP_ORG=Z. mays
Annotation via Blast BLASTX UniProt: No hits

BLASTN TIGR Plant Transcript Assemblies: AI491598, , Expect:1e-139, match=250/250. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: No hits

BLASTX MSU Rice genome: No hits

BLASTN DFCI Maize Gene Index: TC465726, , Expect:1e-105, match=1414/243. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: No hits

BLASTX Arabidopsis thaliana genome: No hits

Sequence Total length: 250
>ZmAffx.15.1.A1_at gb|AI491598
ctgtcttgagttcaggcgaataccttctgtctccaaggtttagccttcaacctaagggaa
tctaaaaggtaaacatgatggactcatcaaggagccacaacacgttcattcttttagaat
gttcggttattagggtggaaggtatacagagctgtaaaccggtgatgcacattcatgctt
catctaaaacaaccgaaggttatggcttctaagcctctcgcgcagatcgttaaatgatca
gatattaaga
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters