Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
FAQs
Submission Help
Presentations
Glossary
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Microarray Sequence ID: ZmAffx.15.1.A1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment
MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V2)

EXPRESSION DETAILS for ZmAffx.15.1.A1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for ZmAffx.15.1.A1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): No hits

Brachypodium distachyon Alignment at Brachybase: No hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:AI491598 /DB_XREF=gi:4646431 /DB_XREF=486019C07.x4 /TID=ZmAffx.15.1 /CNT=1 /FEA=EST /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /REP_ORG=Z. mays
Annotation via Blast BLASTX UniProt: No hits

BLASTN TIGR Plant Transcript Assemblies: AI491598, , Expect:1e-139, match=250/250. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: No hits

BLASTX MSU Rice genome: No hits

BLASTN DFCI Maize Gene Index: TC465726, , Expect:1e-105, match=1414/243. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: No hits

BLASTX Arabidopsis thaliana genome: No hits

Sequence Total length: 250
>ZmAffx.15.1.A1_at gb|AI491598
ctgtcttgagttcaggcgaataccttctgtctccaaggtttagccttcaacctaagggaa
tctaaaaggtaaacatgatggactcatcaaggagccacaacacgttcattcttttagaat
gttcggttattagggtggaaggtatacagagctgtaaaccggtgatgcacattcatgctt
catctaaaacaaccgaaggttatggcttctaagcctctcgcgcagatcgttaaatgatca
gatattaaga
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters