Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 58k NSF Array Microarray Sequence ID: MZ00000002

Sequence ID: Enter a probe set ID
Array provider NSF Maize Oligonucleotide Array Project  
Sequence Type TIGR Oligo ID: TM00000002; Operon ID: MZ00000002; Derived from sequence: TC333628.
Probe Set Details MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V1)
No expression data available for MZ00000002
Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os08g02300.1, no apical meristem protein, putative, expressed, Expect:1e-83, match=80/83. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi1g38730.1, , Expect:1e-54, match=60/78. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation TIGR ricearray.org, 2007-03-13
"putative OsNAC7 protein {Oryza sativa (japonica cultivar-group);} "
Annotation via Blast BLASTX UniProt: UniRef90_B4FPS5, Putative uncharacterized protein n=1 Tax=Zea mays RepID=B4FPS5_MAIZE, Expect:6e-43, match=81/83. Blast executed on 2009-07-02 against Uniref90 (July '09) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA192042_4577, , Expect:0, match=1143/1144. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: XP_002443765, hypothetical protein SORBIDRAFT_07g001550 [Sorghum bicolor], Expect:2e-85, match=83/83. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os08g02300.1, no apical meristem protein, putative, expressed, Expect:1e-83, match=80/83. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC462239, , Expect:0, match=1283/1140. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi1g38730.1, , Expect:1e-54, match=60/78. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT2G46770.1, | Symbols: NST1, EMB2301, ANAC043 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein | chr2:19220917-19222822 REVERSE LENGTH=366, Expect:8e-63, match=77/84. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1258
>MZ00000002 MZ00000002 AZM4_123638_1
ATGAGCATCTCGGTGAACGGGCAGTCGTGCGtgccgccggggttccgcttccaccccacg
gaggaggagctgctcaactactacctccgcaagaaggtggcctcccaggagatcgacctc
gacgtcatccgcgacgtcgacctcaacaagctcgagccatgggacATCCAAGAGAAATGC
AAGATCGGGTCGGGTCCCCAGaacgactggtacttcttcagccacaaggacaagaagtac
ccgacggggacgcgcaccaaccgcgccacggccgccgggttctggaaggccaccggccgc
gacaaggccatctacaacgccgtcaagcgcatcggcatgcgcaagacgctcgtcttctac
aagggccgcgcgccgcacggccagaagtccgactggatcatgcacgagtaccgcctcgac
gaccccgctgctgctgctgctgctggatccggtgatgccgtggccaacgacgacgcagcc
gccacGgctgctgctgctgccgccgcgtcgTCGGACGGCGggcaggaggacggctgggtg
gtgtgcagggtgttcaagaagaagcaccaccacaaggagtcAggtgggggcgggggcaac
aagcacggcagcagtaacagcgagcatgggcacggcggcgccggcaaggCATCGGCTGCG
GCTGCGGCTGCGGCGCACCAGCACCAGCACCATGGAGGCCTGCAGTACTCCTCCAGCGAC
GAGGCGCTGGACCAGATCCTGCAGTACATGGGCAGGTCGTGCAAGCAGGAGCACGAGCTG
GTGTCGCCGGCGCCGGCGCCGCCGGGACGGGCGGCGGCGTCCAGGTACCTCCGGCCCATC
GAGACCGTTCTGGGCGGGCACGCGTTCATGAAGCTTCCCGCGCTCGAGAGCCCGTCCGCG
GCCGCGTCCGCATCGCTGACACAGCCGGCGCAGCACGACGAGCTCTACCGCGCCGCCGGG
AACGGGATCACGGACTGGGCCATGATGGACCGGCTGGTGGCGTCGCACCTGAACGGGCAG
CAGGCGcccgccgcggcggaccagctcggcggcggctgcggcttcgacgcggacgccggc
gccgaagacgcggacgccggcctcgccTTCTACTCCGCCGCCGCCAGCCGGCTGCTcggc
tccggcggcggcgccggcagcgacgacgacctgtggagcttcacgcggtcgtcggtttcg
tcaacggcggcggcggcggccacgtccacGGAGCGGCTCAGCCACGTGTCACTGTAG>
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters