Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Fusarium
Magnaporthe grisea
Puccinia graminis
Pyrenophora tritici-repentis
Ustilago maydis
Verticillium dahliae
Phytophthora
Heterodera
Sinorhizobium
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 58k NSF Array Microarray Sequence ID: MZ00018754

Sequence ID: Enter a probe set ID
Array provider NSF Maize Oligonucleotide Array Project  
Sequence Type TIGR Oligo ID: TM00018754; Operon ID: MZ00018754; Derived from sequence: TC293633.
Probe Set Details MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V1)
No expression data available for MZ00018754
Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os05g50960.1, polygalacturonase, putative, expressed, Expect:1e-105, match=178/218. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g43750.1, , Expect:2e-92, match=155/218. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation TIGR ricearray.org, 2007-03-13
"putative polygalacturonase {Oryza sativa (japonica cultivar-group);} "
Annotation via Blast BLASTX UniProt: UniRef90_B6TDS0, Polygalacturonase n=1 Tax=Zea mays RepID=B6TDS0_MAIZE, Expect:1e-121, match=215/218. Blast executed on 2009-07-02 against Uniref90 (July '09) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA180454_4577, , Expect:0, match=878/879. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: NP_001149385, LOC100283011 [Zea mays], Expect:1e-124, match=215/218. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os05g50960.1, polygalacturonase, putative, expressed, Expect:1e-105, match=178/218. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC474500, , Expect:0, match=1576/877. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g43750.1, , Expect:2e-92, match=155/218. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G23820.1, | Symbols: | Pectin lyase-like superfamily protein | chr4:12397217-12400050 REVERSE LENGTH=445, Expect:3e-77, match=125/218. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1592
>MZ00018754 MZ00018754 TC225772
GGGATCTTGTCCCCTCCTGCTCGTCGCTTCCCTCACTCTCACAGCCACGCCACGCCACGA
GAGAAGAATGCCGCCGACGCTGGGCCTGCTCCTCGCGGCGGCGGCGGCGGTCCTGCTGCT
GCTGCTGCCGCCGCCACCATCGGCGGGGGCGCAGGAGACGTGCTGGTTGGGGCCGGCGCC
GCGGCGCGGGGCGTGGATGTCCGTGGCCAGCTTCGGGGCGCGCGGGGACGGGCAGACGCT
CAACACGGGCGCGTTCGCGCGCGCCGTGGCGCGCATCGCGCGTCGCCGGGGCGCGCGGGG
CGGCACGCTGCTGTACGTGCCGCCCGGGGTGTGGCTCACGGGCCCCTTCAACCTCACCTC
CCACATGACGCTCTTCCTCGCCCGCGGCGCCATCGTCCGCGCCACCCAGGACACGTCGAG
CTGGCCGCTCATCGACCCGCTGCCGTCGTACGGGAGAGGGCGCGAGCTGCCTGGCGGGAG
ATACATGAGCTTGATCCACGGCCACGGTCTGCAGGACGTCTTCATCACAGGTGAGAACGG
CACCATCGACGGCCAAGGCGGCGTGTGGTGGGACATGTGGAAGAAGCGCACGCTGCCCTT
CACGAGGCCGCACCTGCTGGAGCTCATGTACTCCACCGACGTCGTCGTCTCCAACCTCGT
CTTCCAGGACTCGCCGTTCTGGAACATCCACCCGGTTTACTGCAGCAACGTAGTGATAGC
AAACCTGACTGTGTTGGCGCCGCACGACTCCCCCAACACCGACGGGATCGATCTAGATTC
AAGCAGCAACGTGTGCGTCGAGGACTGCTACATCTCCGCCGGCGACGACCTGATCTCCAT
CAAGAGCGGGTGGGACGAGTACGGCGTGGCCTTCGGCCGCCCAAGCTCCGGCATCACGGT
CCGGAGGATAACCGGGTCGGGCCCGTTCGCCGGCTTCGCGGTCGGGAGCGAGACCTCGGG
CGGCGTGGAGGACGTCGTGGCCGAGCACCTGAGCTTCTCCGGCGTGGGCGTCGGGGTCCA
CGTGAAGACAAACTCGGGCAGGGGCGGCTTCATCCGGAACGTCACCGTCTCCCAGGTGAC
CCTGGACGGCGCCCGCTACGGCCTGAGGATCGCCGGCGACGTTGGGGGCCACCCCGGCGC
GTCCTACAACGCGAGCCTGCTCCCCGTCATCGACGGCGTGGCGGTCAGGAACGTCTGGGG
CCGGAACGTCCGGCAGGCCGGGCTCATACGGGGCATCAGGGACTCGGTCTTCAGTAACAT
TTGCCTCTCCAACGTGAAGCTCTATGGCATTGGCAGCGACTCCATCGGGCCGTGGAGATG
CCGAGCCGTCAGTGGCAGCGCACTCGACGTGCAACCGTCGCCATGTGCGGAGCTGGCTAG
TACGTCCGGGACAGGTTTCTGTACCTGAATCAGTTTTTCCGCCTCCTATAGCAGCAATAA
AGACGTCAGCATTTCTCCATTTTGTTCATCACCTACAGGGCCCTTTGTTTCTTTGGCAAA
CTCTTCTGCGATTCAGCTGTCACTGTTGAATTCTGCTGTTGGCAGAGGATAATCTATTTT
TACCAGCAGCCATTGCAAGAGAATTATTTTT>
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters