Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize Cornchip0 8k Microarray Sequence ID: Zm1.14139.1.A1_at

Sequence ID: Enter a probe set ID
Sequence Type mRNA
Probe Set Details Probe Sequences & Alignment
No expression data available for Zm1.14139.1.A1_at
Alignments and Assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os05g01810.1, xylem cysteine proteinase 2 precursor, putative, expressed, Expect:3e-42, match=75/82. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g39320.1, , Expect:8e-40, match=73/84. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2004-11-29
gb:CB351114 /DB_XREF=gi:28986394 /DB_XREF=MEST260-D07.univ /CLONE=MEST260-D07 /TID=Zm.14139.1 /CNT=12 /FEA=mRNA /TIER=ConsEnd /STK=2 /UG=Zm.14139 /UG_TITLE=Zea mays PCO132946 mRNA sequence /SOURCE=Zm1
Annotation via Blast BLASTX UniProt: UniRef90_B6TIC7, Putative uncharacterized protein n=1 Tax=Zea mays RepID=B6TIC7_MAIZE, Expect:6e-45, match=82/82. Blast executed on 2009-07-02 against Uniref90 (July '09) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA169464_4577, , Expect:0, match=482/482. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: NP_001149806, LOC100283433 [Zea mays], Expect:7e-46, match=82/82. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os05g01810.1, xylem cysteine proteinase 2 precursor, putative, expressed, Expect:3e-42, match=75/82. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC515575, , Expect:0, match=1443/473. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g39320.1, , Expect:8e-40, match=73/84. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT1G20850.1, | Symbols: XCP2 | xylem cysteine peptidase 2 | chr1:7252208-7253537 FORWARD LENGTH=357, Expect:3e-38, match=70/80. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 482
>Zm1.14139.1.A1_at Zm1.14139.1.A1_at
AGGCGTCCGGGAGGCACTTCCAGTTCTACAGCGGGGGCGTGTTCGATGGACCGTGCGGGT
CGGAGCTGGACCACGGCGTGGCGGCGGTGGGCTACGGCAGCAGCAAGGGGCAGGACTACA
TCATCGTCAAGAACTCGTGGGGCACCCACTGGGGCGAGAAGGGCTACATCCGCATGAAGA
GGGGCACCGGCAAGCCGGAGGGCCTCTGCGGCATCAACAAGATGGCATCCTACCCGACCA
AGGACCATTGATGGATCATGGACGACGGAGATCATATCTATCTTCCCTTCCCTTTCATCC
GACTCTTTCGATTTCCATCGTTTGCCCCCTTTTCCTGAATGTGTGTGNTTTTTTTTATAT
ATTACTGTGTCAAGTAATTTCTCGATGGATCGATCGAGGAAGAACGACAAACATGCACTC
AAGCACGAGCGCAGCAATGTCATCTTTCTCTTCATTTGGTGCGTTGAAATGACGAATATC
AA
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters