Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Medicago 61k Medicago sativa Sequence ID: Msa.1033.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Msa.1033.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Msa.1033.1.S1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
iMsa.1033 /TID=Msa.1033.1 /CNT=1 /FEA=mRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF=
Annotation via Blast BLASTX UniProt: UniRef90_P93306, NADH dehydrogenase [ubiquinone] iron-sulfur protein 2 n=45 Tax=Magnoliophyta RepID=NDUS2_ARATH, Expect:1e-88, match=159/162. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: CO511921, Cluster: NADH dehydrogenase subunit 7; n=1; Beta vulgaris subsp. vulgaris|Rep: NADH dehydrogenase subunit 7 - Beta vulgaris subsp. vulgaris, Expect:0, match=492/492. Blast executed on 2007-10-23 against Medicago truncatula release 2 and M. sativa release 2 show top hits

BLASTX NCBI Reference Sequence: YP_003587352, NADH dehydrogenase subunit 7 [Cucurbita pepo], Expect:3e-90, match=161/162. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Medicago truncatula Gene Index: No hits

BLASTX Arabidopsis thaliana genome: ATMG00510.1, | Symbols: NAD7 | NADH dehydrogenase subunit 7 | chrM:132071-138153 FORWARD LENGTH=395, Expect:9e-85, match=152/162. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 492
>Msa.1033.1.S1_at affx|gi|50316795|gb|CO511921.1|CO511921
ggggagacttttgaattgcgaggtaccattacgagctcaatatatacgagtgttattttg
tgaaataactcgaattttaaatcatttacttgctttaactactcatgctatggatgtggg
agcattaactccgttcctgtgggcttttgaggagcgggagaaattgttggaattctatga
aagagtttcgggagccaggatgcatgccagtttcatacgaccaggtggagtggcacaaga
tctgcctcttggcttatgtcgagatattgattccttcacacaacaatttgcttctcgtat
tgacgaattagaagagatgttaaccggcaaccgtatctggaaacaacgattagtggatat
cggtactgtcactgcacagcaagcaaaggattggggattcagtggtgtaatgttaagagg
ttcaggggtatgctgggatttgcgaagagcagcaccttacgatgtttatgaccaattgga
ttctgacgtacc
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters