Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Medicago 61k Medicago truncatula Sequence ID: Mtr.10012.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Mtr.10012.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Mtr.10012.1.S1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
TC105246 /FEA=mRNA /DEF=weakly similar to UP|P79078 (P79078) Delta-9 fatty acid desaturase , partial (14%)
Annotation via Blast BLASTX UniProt: UniRef90_Q5KAM4, Stearoyl-CoA 9-desaturase, putative n=3 Tax=Filobasidiella/Cryptococcus neoformans species complex RepID=Q5KAM4_CRYNJ, Expect:4e-34, match=72/176. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA36719_3880, Delta-9 fatty acid desaturase [Cryptococcus curvatus], Expect:0, match=682/682. Blast executed on 2007-10-23 against Medicago truncatula release 2 and M. sativa release 2 show top hits

BLASTX NCBI Reference Sequence: NP_001169125, hypothetical protein LOC100382970 [Zea mays], Expect:6e-24, match=61/176. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Medicago truncatula Gene Index: TC171457, weakly similar to UniRef100_P79078 Cluster: Delta-9 fatty acid desaturase; n=1; Cryptococcus curvatus|Rep: Delta-9 fatty acid desaturase - Cryptococcus curvatus, partial (14%), Expect:0, match=682/682. Blast executed on 2010-11-03 against MtGI(DFCI) release 10 show top hits

BLASTX Arabidopsis thaliana genome: No hits

Sequence Total length: 682
>Mtr.10012.1.S1_at affx|TC105246
gagcaactttattctaatgaagtttctgcacgtggaaacttattacttgccttaatgact
cacggtgaagggtatcacaactttcatcatgaatttccgaaggatttccgaaatggatac
cgtttatttgattgggatccctcaaaatggattatatttactctacataaattaacaaac
caagttccaaaagtatctcgtgttcctgaaaatgaagttcgcaaagcaatggtaaatatg
gaaattattaaagcccaagaaaaatgtaaaaaatacgattggggaattgatccatcctca
ttgcccgtcatcacttacgagcagtataaacaaaaacaagaacaagaaggaaaagaatgg
atattagttgatgaatttgtgttggatgtttcgtcatttaaggatgatcatcctggtggt
gcaaaaattttgaagaattattatggtaaagactccactaaagcattctatggtggtttg
aatgatcattctaaagctgccaataccatgacggctatgtttagagttgccaaaatcgag
aagaatcaaaaggaagaatagaacaatatttaccaattatattttttaaacataaaatct
tgtaactttattttaaactaataatagtacaatagtgatatcatttaatcaataaaacaa
taaacaaatatttttatactat
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters