Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Medicago 61k Sinorhizobium meliloti Sequence ID: Sme.1888.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Sme.1888.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Sme.1888.1.S1_at

Alignments and Assemblies PLEXdb Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
TIGR|NT01SMB0150 /FEA=mRNA /DEF=D-isomer specific 2-hydroxyacid dehydrogenases family protein {Sinorhizobium meliloti 1021}
Annotation via Blast BLASTX UniProt: UniRef90_G4RQ12, Lactate dehydrogenase and related dehydrogenases n=1 Tax=Thermoproteus tenax Kra 1 RepID=G4RQ12_THETE, Expect:3e-36, match=97/259. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: No hits

BLASTX NCBI Reference Sequence: XP_002978650, hypothetical protein SELMODRAFT_109271 [Selaginella moellendorffii], Expect:2e-48, match=118/304. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Medicago truncatula Gene Index: No hits

BLASTX Arabidopsis thaliana genome: AT1G79870.1, | Symbols: | D-isomer specific 2-hydroxyacid dehydrogenase family protein | chr1:30044794-30045851 FORWARD LENGTH=314, Expect:7e-47, match=113/308. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 933
>Sme.1888.1.S1_at affx|TIGR|NT01SMB0150
atgacgatgctccgggacatcaccatccttcaggccgccgagctgccggaaaagaccgat
ctggaactgaaggaaaccttcaataccgtccggctgccgagggatgcctcggcgatcggg
ccgtttctttccgagtacggagcgcgtattcgcggcatcgccgtcaggcacgcccatatc
gatgcggccatgctcgaccgcctgccggcgctggagatcatctccagctacagcgccggt
ctcgacggcatcgatgtcgagaccgcgcatgcccgtggcgtcgtcgtccgcaacacgtcg
aagatccttgccgaggatgtcgccgatcttgcgcttgcactgagcatttcggccacgcgc
ggcctcatgcgcggccacgatttcgtgcgcgagggcaagtggggcgagagcgccttcccg
ctcggccgctcgctgagatcgatgaagacggggatcgtcgggcttggacatatcggctcg
gcggtcgccgcccggctgagcgtgatgggagcgccgaccgcctattacggcccgagacgg
aagcctgtcgaccttccctacttcgacggcatcggggcgctcgcggcctgggccgatctc
ctgatcgtcacctgtcctgcgagtcccgagacgatcggcctcgtcaatgccgccgtgctc
gcgagccttggctcggaaggctatctggtgaacgtctcgcgcggcacgatcgtcgacgaa
caggcgctcatcacggcgctggccggaaacgggatcgccggcgtggccctcgacgtcttt
gagaaggagcccttcgtcccggaagcgctccgcaccgacccgcgcgtcgtcctgtcgccg
cacatgggtagcggcacgcgcgagacgcggcaacagatgggcgacagcatggtcgccgca
ttggtggagcatttcgagagccgaagcgcgtga
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters