Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Poplar 61k Microarray Sequence ID: Ptp.1088.1.S1_s_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Ptp.1088.1.S1_s_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Ptp.1088.1.S1_s_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:BU831466 /DB_XREF=gi:24009817 /DB_XREF=T021H03 /TID=Ptp.1088.1 /CNT=3 /FEA=EST /TIER=ConsEnd /STK=0 /UG=Ptp.1088 /UG_TITLE=Transcribed locus /REP_ORG=P. tremula x P. tremuloides
Annotation via Blast BLASTX UniProt: UniRef90_P20721, Low-temperature-induced cysteine proteinase (Fragment) n=3 Tax=Solanum RepID=CYSPL_SOLLC, Expect:5e-11, match=28/55. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA17134_3694, Cysteine protease [Anthurium andraeanum (Flamingo lily)], Expect:1e-164, match=370/365. Blast executed on 2007-10-23 against Poplus alba x Populus tremula release 2, Populus alba x Populus tremula var. glandulosa release 2, Populus deltoides release 2, Populus euphratica release 2, Populus tremula release 2, ... show top hits

BLASTX NCBI Reference Sequence: XP_002317417, predicted protein [Populus trichocarpa], Expect:2e-54, match=93/94. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Poplar Gene Index: TC176610, similar to UniRef100_A7QDJ5 Cluster: Chromosome chr10 scaffold_81, whole genome shotgun sequence; n=1; Vitis vinifera|Rep: Chromosome chr10 scaffold_81, whole genome shotgun sequence - Vitis vinifera (Grape), partial (46%), Expect:0, match=555/548. Blast executed on 2010-11-03 against PplGI(DFCI) release 5 show top hits

BLASTX Arabidopsis thaliana genome: AT1G47128.1, | Symbols: RD21, RD21A | Granulin repeat cysteine protease family protein | chr1:17283139-17285609 REVERSE LENGTH=463, Expect:5e-11, match=24/54. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 551
>Ptp.1088.1.S1_s_at gb|BU831466
aagctttttagttcctgcataatctatggttgctgcccatatgagaacgctgtttgctgt
gcagaatctacatactgctgccctagtgattacccgatttgtgatgtcgatgacgggctc
tgcctcaggggccagggagatcaccttggagtggctgcgcgccggcgacacatggctaac
tacaagtttccatggaccaagtttgaggagaaaaaggaaacaaaccaacctgttcttcaa
tggaagaggagccttcgctgcaatgctctgaattacatggaatagagttcgtaatccttc
agccaaatcaatgttttcattactcttagcacttgtttttnttccgagtaggcatttggc
catcctataaagcagaacgaataagataagggaaattgagattggagtttctttgaatct
ttatagagacaacaacttttatttttccttgcagactttccgttgtttatcgtggcttgt
gattttattttcaagccatgttcagtatttttatgttagtccttttaatttagttcctga
gatttaaca
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters