 |
|
 |
PLEXdb is committed to making
expression data publicly available to researchers world-wide...
|
|
 |
|
 |
|
|
|
Rice 45k NSF Array Microarray Sequence ID: TR030003 |
|
|
|
Array provider
|
NSF Rice Oligonucleotide Array Project
|
|
Oligo Origin
|
Match ids: LOC_Os01g01050.1 LOC_Os01g01050.2
Match type: Rice Model
Array Platform: NSF 45K (23K A)
Oligo length: 63
GC content: 55.56
|
|
Probe Set Details
|
No expression data available for TR030003
|
|
Alignments and Assemblies
|
• PLEXdb Blast
|
|
Model Genome Alignments
|
• Rice Alignment at Gramene (by probe set id)
On the Gramene Featureview page, click the probeset location on the chromosome to see the contig view.
• Rice Alignment at Gramene (by locus name): LOC_Os01g01050.2, R3H domain containing protein, expressed, Expect:7e-05, match=20/20. Blast executed on 2009-09-23 oligo sequences against Rice genome, TIGR release 6.1 show top hits
• Brachypodium distachyon Alignment at Brachybase: Bradi3g01330.1, , Expect:0.002, match=17/20. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits
|
| Probe Set Annotation
|
NSF Rice Oligonucleotide Array Project, 2006-02-28
R3H domain containing protein, expressed
|
|
Annotation via Blast
|
• BLASTN TIGR Plant Transcript Assemblies: TA59622_4530, Hypothetical protein P0672D08.5 [Oryza sativa (japonica cultivar-group)], Expect:1e-28, match=63/63. Blast executed on 2007-11-05 oligo sequence against Oryza sativa release 2 show top hits
• BLASTX NCBI Reference Sequence: NP_001041737, Os01g0100600 [Oryza sativa Japonica Group], Expect:0.0004, match=20/20. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits
• BLASTX MSU Rice genome: LOC_Os01g01050.2, R3H domain containing protein, expressed, Expect:7e-05, match=20/20. Blast executed on 2009-09-23 oligo sequences against Rice genome, TIGR release 6.1 show top hits
• BLASTN DFCI Rice Gene Index: TC415427, Single-stranded nucleic acid binding R3H domain containing protein contains InterPro domain(s): IPR001374 has GO asignment(s): GO:0003676 supported by AK121362, Expect:1e-28, match=2025/63. Blast executed on 2010-11-03 oligo sequence against OsGI(DFCI) release 18 show top hits
• BLASTX Brachypodium distachyon genome: Bradi3g01330.1, , Expect:0.002, match=17/20. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits
• BLASTX Arabidopsis thaliana genome: No hits
|
|
Sequence
|
Can not find consensus sequence for TR030003.
Total length: 65
>TR030003
GGACAGCAGTGGCAAAACCTAGGCATGTTCCTGCTGTTGCTCAACGGATGATCGCGCATG
CAC
|
|
|
| | |
