Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Rice 45k NSF Array Microarray Sequence ID: TR030003

Sequence ID: Enter a Rice 45k or Rice 20k ID
Array provider NSF Rice Oligonucleotide Array Project  
Oligo Origin Match ids: LOC_Os01g01050.1 LOC_Os01g01050.2
Match type: Rice Model
Array Platform: NSF 45K (23K A) Oligo length: 63 GC content: 55.56
Probe Set Details No expression data available for TR030003
Alignments and Assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by probe set id)
On the Gramene Featureview page, click the probeset location on the chromosome to see the contig view.
Rice Alignment at Gramene (by locus name): LOC_Os01g01050.2, R3H domain containing protein, expressed, Expect:7e-05, match=20/20. Blast executed on 2009-09-23 oligo sequences against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi3g01330.1, , Expect:0.002, match=17/20. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation NSF Rice Oligonucleotide Array Project, 2006-02-28
R3H domain containing protein, expressed
Annotation via Blast BLASTN TIGR Plant Transcript Assemblies: TA59622_4530, Hypothetical protein P0672D08.5 [Oryza sativa (japonica cultivar-group)], Expect:1e-28, match=63/63. Blast executed on 2007-11-05 oligo sequence against Oryza sativa release 2 show top hits

BLASTX NCBI Reference Sequence: NP_001041737, Os01g0100600 [Oryza sativa Japonica Group], Expect:0.0004, match=20/20. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os01g01050.2, R3H domain containing protein, expressed, Expect:7e-05, match=20/20. Blast executed on 2009-09-23 oligo sequences against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Rice Gene Index: TC415427, Single-stranded nucleic acid binding R3H domain containing protein contains InterPro domain(s): IPR001374 has GO asignment(s): GO:0003676 supported by AK121362, Expect:1e-28, match=2025/63. Blast executed on 2010-11-03 oligo sequence against OsGI(DFCI) release 18 show top hits

BLASTX Brachypodium distachyon genome: Bradi3g01330.1, , Expect:0.002, match=17/20. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: No hits

Sequence
Can not find consensus sequence for TR030003.
Total length: 65
>TR030003
GGACAGCAGTGGCAAAACCTAGGCATGTTCCTGCTGTTGCTCAACGGATGATCGCGCATG
CAC
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters