Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Rice 57k Microarray Sequence ID: Os.10220.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Os.10220.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Os.10220.1.S1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by probe set id)
On the Gramene Featureview page, click the probeset location on the chromosome to see the contig view.
Rice Alignment at Gramene (by locus name): LOC_Os07g48820.2, transcription factor, putative, expressed, Expect:1e-139, match=262/318. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi1g17210.1, , Expect:1e-129, match=247/324. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:AB051295.1 /DB_XREF=gi:17025919 /GEN=OsNIF2 /TID=Os.10220.1 /CNT=28 /FEA=FLmRNA /TIER=FL /STK=3 /UG=Os.10220 /DEF=Oryza sativa OsNIF2 mRNA for bZIP transcription factor, complete cds. /PROD=bZIP transcription factor /FL=gb:AB051295.1 gb:AK100440.1 /REP_ORG=O. sativa
Annotation via Blast BLASTX UniProt: UniRef90_P23923, Transcription factor HBP-1b(c38) n=4 Tax=Poaceae RepID=HBP1B_WHEAT, Expect:1e-102, match=207/319. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA41051_4530, BZIP transcription factor [Oryza sativa (Rice)], Expect:0, match=2206/2207. Blast executed on 2007-10-23 against Oryza sativa release 2 show top hits

BLASTX NCBI Reference Sequence: NP_001060695, Os07g0687700 [Oryza sativa Japonica Group], Expect:1e-139, match=262/318. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os07g48820.2, transcription factor, putative, expressed, Expect:1e-139, match=262/318. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Rice Gene Index: TC420790, homologue to UniRef100_Q6IVC3 Cluster: BZIP transcription factor; n=1; Oryza sativa Japonica Group|Rep: BZIP transcription factor - Oryza sativa subsp. japonica (Rice), complete, Expect:0, match=2235/2181. Blast executed on 2010-11-03 against OsGI(DFCI) release 18 show top hits

BLASTX Brachypodium distachyon genome: Bradi1g17210.1, , Expect:1e-129, match=247/324. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT5G06950.4, | Symbols: AHBP-1B, TGA2 | bZIP transcription factor family protein | chr5:2152323-2154174 FORWARD LENGTH=331, Expect:1e-102, match=197/318. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 2207
>Os.10220.1.S1_at gb|AB051295.1
ctctctccacctcctccactctcccaccacnacgagaccttctcgangcttcctcccccc
caaaccccttccgctcctcctcctcctcccaaatccaccacggcgacgccgccgccgcag
agcccctagctcccggaggtccctcgcccccgccagctccgacggcctcacggaaggagg
agtaacgtgggcgttgattggatttttttgttttccccccaccttgagtgagtctgtgcc
gtttccccggcggcgagggagggcagagggctgatcatggtcgtgcgccgccggtgcctt
gccgagatttcccccaaccgccaccgacgatcgttcacttggcacaaaggggagtagcac
tgtccaagctgttgtggtccgtcagggagattggccaacctgtggggtttcagatcgaca
taagtacgtcagtatttcagccatcgatcaatctggcggttcatagggctgtgcttgcaa
cctttctggcagaaaggagagagcaaagtgatttgctgtctcctgttgattgtggcctgt
tgaggcccagtaatggcagatgctagttcaaggactgacacatcgattgttgtagacaac
gacgacaaaaaccaccagttagaaaacggacatagtggtgcagtcatggcttctaactct
tcagatagatctgacagatctgacaaacttatggaccaaaagacaattcggcggcttgct
caaaatcgtgaggcagcaagaaaaagtcggctgaggaaaaaggcatatgtgcaacaacta
gagagcagtaagctgaagcttgcacagctagagcaggaacttcagaaagctcgtcagcag
ggaatcttcatctctagctctggagaccagacccatgccatgagtggaaatggggcattg
acttttgacttagaatacactagatggctcgaggagcaaaataagcagataaatgagttg
aggacagcagtgaatgctcatgcaagtgacagtgaccttcgtcttattgttgatggcata
atggcgcattatgacgaggtattcaaggttaagggtgtagctgcaaaggccgatgtgttt
catatactttcaggcatgtggaagacacccgcagaaagatgcttcctgtggcttggtggt
ttccgtccatctgagcttctaaagctcctagcaaatcacctcgaacctttaaccgagcag
cagttgctgggattaaacaacctccaggaatcttctcagcaggcggaggatgcactttca
caaggtatggaagcactgcagcaatctctggcagatactttggctggatctctcgnttca
tcagggtcttctgggaatgtggcgaactacatgggtcagatggcaatggccatgggtaaa
ctaggaacgctcgagaatttcctttgccaggcggacaacctgcgacagcagacattgcat
caaatgcaacgaattctgacgatccggcaagcctcgcgtgctcttcttgccatacacgat
tacttttcacgcttgcgtgctttgagttcgctgtggcttgctaggccacgggagtaacaa
aatggtcatgtgtgcctgtgacgaggttagacgctcattttgatggacngcagataattg
ggtttttccctgtacaattgtgtttggcagctgtggagctaaagttaaaaactgtaccta
aagtggtgtatgcaaataggtgaagcctctaagtaagttataacgattgcattattgtgt
tagcaataaaagttgggtaattcaggatgtgtcctgagttgttttgttgtagtagaagaa
ctgcatgtagtggctggaaatgcagtgttgaatgtaactaaagctctgctgctcacgttg
cataatgttgtgtagtaatagttagctagtgatgcccattttacctgcactcctctggga
agctgaaactgcaacctgaagcaaccacggtgcagaagaccgcatgcatggtaaatgatt
aaaaggatatatatgggctcaacatcgctgccaaatcctgagataatgaacaggcatgct
aaactgctacttccacatgaaacntcccagttgacatgaagaatgagctgttcagtttta
tggtttctgtgttgcactgtacataattcctgtacgggtctgaanttatcctgaaatcat
gctaaactgcagaagcatatgaaatctccagaccggntgacatgaaa
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters