Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Soybean 61k Glycine max Sequence ID: Gma.144.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment
View in GBrowse at Soybase

EXPRESSION DETAILS for Gma.144.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Gma.144.1.S1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:AF065435.1 /DB_XREF=gi:3851529 /TID=Gma.144.1 /CNT=1 /FEA=FLmRNA /TIER=FL /STK=1 /UG=Gma.144 /DEF=Glycine max nodulin mRNA, complete cds. /PROD=nodulin /FL=gb:AF065435.1 /REP_ORG=G. max
Annotation via Blast BLASTX UniProt: UniRef90_D2XNQ8, Flotillin-like protein 1 n=7 Tax=Medicago truncatula RepID=FLOT1_MEDTR, Expect:1e-178, match=328/478. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA71850_3847, Nodulin [Glycine max (Soybean)], Expect:0, match=1594/1594. Blast executed on 2007-10-23 against Glycine max release 2 and Glycine soja release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002324888, predicted protein [Populus trichocarpa], Expect:0, match=343/477. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Soybean Gene Index: TC355040, UniRef100_Q9ZTB2 Cluster: Nodulin; n=1; Glycine max|Rep: Nodulin - Glycine max (Soybean), complete, Expect:0, match=1613/1594. Blast executed on 2010-11-03 against GmGI(DFCI) release 15 show top hits

BLASTX Arabidopsis thaliana genome: AT5G25250.1, | Symbols: | SPFH/Band 7/PHB domain-containing membrane-associated protein family | chr5:8749774-8751430 FORWARD LENGTH=471, Expect:1e-165, match=304/471. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Additional Annotations 2012-03-19 Annotation downloaded from soybase.org/AffyChip/AffyChipv3.txt, Soybase.org)
Soybean gene: Glyma06g06930.2 (evalue: 0, iden percent: 100, percent overlap: 29.58)
TAIR id: AT5G25250.1 (evalue: 0)
1st Uniref: UniRef100_Q9ZTB2 Nodulin n=1 Tax=Glycine max RepID=Q9ZTB2_SOYBN (evalue: 0, iden percent: 81.93, percent overlap: 100)
2nd Uniref: UniRef100_A5BMB0 Putative uncharacterized protein n=1 Tax=Vitis vinifera RepID=A5BMB0_VITVI (evalue: 0, iden percent: 69.81, percent overlap: 96.52)
3rd Uniref: "UniRef100_A7P607 Chromosome chr4 scaffold_6, whole genome shotgun sequence n=1 Tax=Vitis vinifera RepID=A7P607_VITVI" (evalue: 0, iden percent: 69.81, percent overlap: 96.52)
GO process: GO:0008150 biological_process
GO function: GO:0003674 molecular_function
Sequence Total length: 1617
>Gma.144.1.S1_at gb|AF065435.1; /DEF=Glycine max nodulin mRNA, complete cds. /PROD=nodulin
cggctaattggtgtagctttttatcactgcggcagaattaagcataaagatgtacaaggt
agcaaacgcctcagaataccttgtgatcactggggttggaatcacagacataaagcttgc
aaagaaagcatgggttctcccaggccagtcatgcaccgttttcgacctctctccggtgaa
ctacaccttcgaggttcaggccatgagcgccgagaagctccctttcattctccctgcagt
cttcaccatcggtcccagagtggaggacgaagacagccttctcaaatacgccagactcct
ctcctcccacgacaagctctctcaccatgtcaaggagcttgtccagggcatcatcgaggg
tgagacgcgtgtcctcgctgcttccatgaccatggaggagattttcagaggcaccaaatc
gtttaaacaggaagtgttcgagaaggttcagctggagcttaaccagttcggccttctgat
ttacaacgccaacgttaagcaacttgttgacgtgccaggtcatgagtatttctcttactt
gggccagaagactcagatggaagctgccaaccaagccaaagttgacgtggctgaggccaa
gatgaaaggagaggttggatcgaagcagagacaagggcaaacgcttcagaatgctgccaa
gatcgatgcggaaactaagataatatcgacgcagaggcaaggagatggtaagaaggagga
aataaaggtgaggacagaggttaaggtgtttgagaatgagagagaggctgtggtggcaga
ggcaaattccgagcttgcaaagaaaaaagctgtgtgggctcaaacggcgcaggtggcaga
agtggaggccgccaaagctgtggctctcagagaagcggaattgcagagagaagttgagag
gatgaatgctcttacaaggactgagaagcttaaagctgagttcctcagcaaagcaagtgt
tgagtatgaaaccaaggtacaagaggcaaactgggagttgtacaagaagcaaaaggcggc
ggaagcaatattgtttgagaaggagaaagaggcggaagcgcaaaaagcattagcggaggc
agcatttttcagtcggcaacaagaagctgaagcagaactatttgcaaagaaaaaggaggc
agaagggcttgtggcacttgggcaggcccagggggcatatttaaagacacttcttggtgc
actgggaggcaactatggcaacctaagggactacttgatgataaatagtggcatgtttca
agagattgccaagactaatgccgatgcaattcgtggacttgagccaaagattagtatttg
gactaatggtggagatacaaatgatggctatggaagtggtgccatgaaggatgttgctgg
tgtctacaagatgttgccacctttgtttaagacagttcatgagcaaaccggtatgctgcc
acccgcttggatgggaaccctgcccgataatggttcttgagcctctgcttattaatacct
ccacatcatcaaatgtgtgctgctcgcttttcctcttttttattttgccgattggatgca
tgttttgtaaataaggtttcttcaagctcaagctaaaaaaaaaaaaaaaaaaaaaaa
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters