Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Soybean 61k Phytophthora sojae Sequence ID: PsAffx.7TMS-1_s_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for PsAffx.7TMS-1_s_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for PsAffx.7TMS-1_s_at

Alignments and Assemblies PLEXdb Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
7TMS-1 -50 to +150
Annotation via Blast BLASTX UniProt: UniRef90_F6TIH6, Uncharacterized protein n=1 Tax=Ciona intestinalis RepID=F6TIH6_CIOIN, Expect:4e-09, match=69/278. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: No hits

BLASTX NCBI Reference Sequence: No hits

BLASTN DFCI Soybean Gene Index: No hits

BLASTX Arabidopsis thaliana genome: No hits

Additional Annotations
Sequence Total length: 1248
>PsAffx.7TMS-1_s_at affx|PsAffx.7TMS-1;
gcgcactttatcgcgtagatcacttttctgatactctctgcgagtcaagcatggcgctag
tgcaggaggtgctgctgctggcggctgcctgcgtgtcctgcgcgggctgcggcttcttgc
tggccatgtggaggcgcgtggaggcccccaactacgtcagccgccgcatcgtcacgtcgc
tggggcttgcggggctcgtcaccgccgtcgccttcgccatgtccctggtggtgaacggct
ttgggcagaactacagacagcacgaaggactctgctacgcgcaggcgctgacgctgcagt
acttctacttggcgtcgtacctctggaccgcgtgcttcgccttccacctctaccagatca
ttgtcaagcggaatgagtacccggaggagttcctgtgggtgtatcgcggcgttgggtggg
ggctgcctggagtggtgctggtatatctggtgctgcgtcagctaacgggtcatctaggcg
tgggtggagcagaccgtcgatggtgctggatcgcggtccacacgacgcacgaagaagaag
gagaagacccgctcgtttggcggcgggaaggagcgctgcaacagctcctgctgttctacg
cccctgtcctctgcgtgttcgtcttcaacgtgggcgtttatcaccatatcctcaagttcc
tgtatatggatcctatggcgccacgcttccgcgacaaagtcaagatctacctcggcatct
tcttcctgtgctcgatctggggagtgatcaaccggttggtgcagctcttccgcgccgacc
acacggcgaatgagtttctaagtgtgatggagagcgtctgcgacccgttgcagccactat
tgaacgcagtggcgtacggcacgaacaagcagtcgctggagacgtacaaggaacggttct
gcccgtgctggatctactcaacgctgccgtcatccgatgaagaagagtcctctggcatcg
acgagtctccgttgctaccagtcaccgatacaccggaggccccgccgttggaccctttag
accgcgagttcggccactacttcgaccagcgcgcaccacgcagcaagccgcaccgccatc
accacacgaggcgatgaagtgaacaatagcaagaccaaatacggcttggcacgaacgctc
agacgcagcacaaactagcgcagacgtagcttaattaaacgcaggttgataacaggaatg
gcactagagctaacgccttccgacctaactgtcttgatctgtttcttt
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters