Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Wheat 61k Microarray Sequence ID: Ta.10069.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Ta.10069.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Ta.10069.1.S1_at

Alignments and Assemblies PlantGDB PUT assemblies GrainGenes Blast PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os01g47410.2, aspartic proteinase oryzasin-1 precursor, putative, expressed, Expect:0, match=315/408. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g16160.1, , Expect:0, match=298/408. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:BJ233195 /DB_XREF=gi:20050592 /DB_XREF=BJ233195 /CLONE=whe3k23 /TID=Ta.10069.1 /CNT=21 /FEA=EST /TIER=ConsEnd /STK=2 /UG=Ta.10069 /UG_TITLE=Transcribed sequence with weak similarity to protein ref:NP_172655.1 (A.thaliana) putative aspartic proteinase (Arabidopsis thaliana)
Annotation via Blast BLASTX UniProt: UniRef90_P42210, Phytepsin n=3 Tax=Pooideae RepID=ASPR_HORVU, Expect:0, match=298/408. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: TA52521_4565, Putative (1-4)-beta-mannan endohydrolase [Oryza sativa (japonica cultivar-group)], Expect:0, match=993/993. Blast executed on 2007-10-23 against Triticum aestivum release 2 show top hits

BLASTX NCBI Reference Sequence: NP_001043786, Os01g0663400 [Oryza sativa Japonica Group], Expect:0, match=315/408. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os01g47410.2, aspartic proteinase oryzasin-1 precursor, putative, expressed, Expect:0, match=315/408. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Wheat Gene Index: TC382510, similar to UniRef100_P42210 Cluster: Phytepsin precursor (Aspartic proteinase) [Contains: Phytepsin 32 kDa subunit; Phytepsin 29 kDa subunit; Phytepsin 16 kDa subunit; Phytepsin 11 kDa subunit]; n=1; Hordeum vulgare|Rep: Phytepsin precursor (Aspartic prot, Expect:0, match=2296/992. Blast executed on 2010-11-03 against TaGI(DFCI) release 12 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g16160.1, , Expect:0, match=298/408. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT1G11910.1, | Symbols: APA1, ATAPA1 | aspartic proteinase A1 | chr1:4017119-4019874 REVERSE LENGTH=507, Expect:1e-165, match=263/408. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1753
>Ta.10069.1.S1_at gb|BJ233195;
gtggtctgctcctcttccggtctcacttcatcggtattctctctctctctgtaatttgca
gctncgcggcgcaaccatgggaactggccgcctcgtgttccacctcctcctcctctccaa
cgtgctcctccatgccctcctcgccacgcccgcggagggccttgtccgcatcgcgctgaa
gaagcgaccagtcgacgagaacggcgtcgtcctcgtcgctggccgnctcaccggagatga
cgccgaggcaaagggccacgtcgtggcactgaagaactaccacaacgctcagtaccacgg
cgagatcggcatcggaacgccgccgcagaancttcaccgtcatcttcgacacaggcagct
ccaacctctgggtgccctcctccaagtgcttcctctcgattgcatgctacttccatgcga
gctacaaggccaagcggtccagcacgtacaagaagaatggaaaaatagttgcaattcagt
atggaactggtgcaatttctggctatgttagccaggacaatgtgcaagttggtgatgtan
ttgtgaaaaatcaggattttattgaagctaccagggaaccaagtattacttttatggttg
caaaatttgatggcatttttggtcttgggtttaaagaaatctcgaaaggtgatgttgtac
ctgtctggtataacatggttagccaaggcctagttagtagccctattttctcattgtggt
tgaacagacatgccggtgaagggcaagggggagaaattgtgtttggaggaattgatccta
atcatcataacggagatcatacatatgtccctgttactaggaagggatactggcagtttg
atatgggtgatgtcttgattggaggaaattccacaggattatgtgcgtctcgctgtgcag
ctatagcagattctggaacttcattgctttctggtcccacggcgataattactcaaataa
atgaaaagatcggtgcacctggggtagtcagccaagagtgcaaggccgttgtttctcagt
atgggcaacggatcctanatctgctgttaaaggagatggatccatcaaaaatatgctctt
tagtcggtctatgtactccagatggaacacaaggtgtaagggctggtagtcgaagtgtgc
tagatcatgaaggtgggagatcaaatgatgtcatgtgccatgcttgtgagatggctgttg
tatggatgacgaaccaacttgcaaagaatcaaactcaggatcttatttttaagtacatta
atcagctatgtgaccgtattcctagccctatgggagaatcatctgtggactgcggcagac
ttgcatccatgcctgacatcgctttctccatcgggggcaaacagtttgtgctgacaccag
agcaatatatcctgaagatcggtgagggggatgctacccagtgcatcagcggattcacgg
ccatggacattcctcgtccccgtggccctctctggatcctgggcgatatattcatgggag
cctaccataccgtcttcgactatggcaacatgaagattgggttcgcgaaggcggcatagg
gttcccccgtggtgggcggatgagccgcagagctgtctaatcttcaggtcggtttggtct
tgggcatgcaaagcatgtgtgtgcatatgttacatgcttaataatgctcgtatgatccga
gataataataaacctgtctgttatgatttgtccaatataatgaggcaggctttcatactc
annannnannggc
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters