Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Nimblegen Maize Whole-Genome Microarray 385K Microarray Sequence ID: GRMZM2G111423_T01

Sequence ID: Enter a probe set ID
Sequence Type B73_4a.53
Probe Set Details
EXPRESSION DETAILS for GRMZM2G111423_T01
GENE EXPRESSION VARIATION IN EXPERIMENTS for GRMZM2G111423_T01

Alignments and Assemblies
Model Genome Alignments None available
Probe Set Annotation MaizeGDB, 2010-12-13
Lookup GRMZM2G111423_T01 on MaizeGDB B73 RefGen v1
Annotation via Blast
Additional Annotations Annotation from Robin Buell, Michigan State Univ., E. Lansing, MI.
maize 4a.53(V1) gene model GRMZM2G111423 (GRMZM2G111423_T01):
Wax synthase isoform 1
Sequence Total length: 1236
>GRMZM2G111423_T01 from 4a.53 filtered cdna sequence
AAATTCTCAATCTGGTTCGGGCTCCTGGATCGGACCCGAAAAACTGGTGAGATTTGACCT
ACAGCGGAGATGGCCACCGGCGACCTGCGCAGCCTCGCCACCGTCGCGGCCGCGGTGATC
GCGTGCATGGGCTACGCCCGCTTCGCCGCGCGGCGACTCCGCCCGGTCCTGTCCCGCCTT
GCAGCGTTCCTCCCGGTGCTCGCCGTCTTGCCTTTCCTCCCGCTCGCCTTCCGTGCGCTC
CACCCGCGCGGCATCTCCGGCTTCTTCCTCGCCTGGGCCGCCGAATTCAAACTCCTGCTC
CTCGCATGCGGCCAGCGCCCGCTCGATCCGAGCCTCCCGCTGCCCTCCTTCACCGCCATC
GCCACCTTCCCCGTCACACTACGGGATCCCAAGAGCTCCGCCTCGAGGCCGGGCCTGGGG
CTCGTGGAGTCCGCCTCCATGGCCGCGCTGCTCGCGGCCATCGTGTCGCTGTACCGGTAC
GAGGAGCGGATGAACGGTTACGTCCTGCTCACGCTCTACTCCGTGCACGTGTACCTCGCG
CTCGAGCTCGTCCTGGCGGCGGCCGCGGCGGCGTCGCGCGCGCTGATGGGCCTGGAACTG
GAGCCCCAGTTCGACCGGCCCTACCTCTCGTCCTCGCTGCGGGACTTCTGGGGCCGGAGG
TGGAACCTCTCCGTTCCGGCGCTGCTCCGCCAGTGCGTGTTCCGCCCCGTGCGCGCGCGC
CTCGGCGCCGCCGCGGGTGTGCTAGCTGCGTTCGTCGTCTCGGGCCTCATGCACGAGGCC
ATGTTCTCCTACCTCACGCTGCTGCGGCCGACGGGGGAGGCGGCCGCGTTCTTCACGCTG
CACGGGGCGTGCGCGGTGGCGGAGGGGTGGTGGGCCGCGCACGAGGGGTGGCCGCGGCCG
CCGCGCGCCATGGCCACGCCGCTGACACTGGCGTTCGTGGGCGTGACGGCCTTCTGGCTC
TTCTTTCCTCCGCTCACAAGGCCCGGCGCGGACAAGCAGGCCATCGCGGAGTGCGAGGCC
ATGGTCGCTTTTCTGCGGGACACCGCAGCTTGGGCGGTCGACTCCGCCTGGTCAGTCTTG
TCAAGCTGGTCGTAAATTGTGGTCCGCCGTCCGCAACAGGCGTGCGCTGCGCCTGCGCCT
GCGCCTGCGCGTGCCGTGTGCTTTGTCGCCGTGGCATCTGTTTGCACTTTTGTTTTGGGA
TGGTGATAATTTCAGAAATATTCTAGATGAGGAAAA
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters