Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Sugar Cane 8k Microarray Sequence ID: Sof.1126.2.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Sof.1126.2.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Sof.1126.2.S1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os11g04830.1, embryogenesis transmembrane protein, putative, expressed, Expect:1e-93, match=196/389. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi4g43050.1, , Expect:3e-92, match=190/393. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:CA163321 /DB_XREF=gi:35079606 /DB_XREF=SCRLRZ3114A11.g /CLONE=SCRLRZ3114A11 /TID=Sof.1126.2 /CNT=4 /FEA=EST /TIER=ConsEnd /STK=0 /UG=Sof.1126 /UG_TITLE=Transcribed locus, weakly similar to NP_192838.1 Arabidopsis thaliana At4g11000 gene /REP_ORG=S. officinarum
Annotation via Blast BLASTX UniProt: No hits

BLASTN TIGR Plant Transcript Assemblies: CA085850, Embryogenesis transmembrane protein-like [Oryza sativa (japonica cultivar-group)], Expect:0, match=632/632. Blast executed on 2007-10-23 against Saccharum officinarum release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002448966, hypothetical protein SORBIDRAFT_05g002640 [Sorghum bicolor], Expect:1e-127, match=239/387. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os11g04830.1, embryogenesis transmembrane protein, putative, expressed, Expect:1e-93, match=196/389. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Sugarcane Gene Index: TC141051, , Expect:0, match=1536/944. Blast executed on 2010-11-03 against SoGI(DFCI) release 3 show top hits

BLASTX Brachypodium distachyon genome: Bradi4g43050.1, , Expect:3e-92, match=190/393. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: No hits

Sequence Total length: 1164
>Sof.1126.2.S1_at gb|CA163321
cctcgccggcgacccaatccttcacataacctatccccagagatacctggctttcttcta
ctgcaacgcgacagctttcgtcgcatcgctggttatcctgatcctcctcctaagcagcac
attcagcacccaaggaatcaagtactacgcactgcaggtcgccatgatcctggaccttct
tgggctgattggcgcctatgctgccgggagttgcaagcaagtgtccaaatccgtgtacat
ctcggtcattgtggttccagtgttcctctatgttggcatccatgttctggtgttcatgct
tgaagtcttcccaaatcatgccacatggagggagatgctgaaggacaagctggagaagtc
catccccgaatggctcaagaagttgtttgagccacagaccgaggaggaagatgaggaaat
gaaatggaaattggagaagagccgcaagctcctactgctccttgccattcttgcagcagg
cctcacataccangccggcatgagtcccccgggcggcttctggcaacagaacaagacagg
ccatctcattggcaacccagtgctcaatgacaactacccacgtcgttacctngnnnncnt
nnnctgcaatgcaactgccttcgttgcatctctggccatcatcatgctgctggttaacag
nannnnnnngnnnnannnnnnnnnnnnctatgcactcagngtgtgcgtgatccttgacct
ggttgggctcatgggtgcgtntgctgcagggngctccaggaaggtatncacatccatata
tgtcttcgtcctggtctttgcagttctaatatgcatcgnnctccaagttattctggttgt
gtcnnagtcgnttcagggtctcttgcagagactcctgtccttcntcgangtaanagagga
ngaagctggtgacacattgccgcatacagctgctgatncagaggcacaagatccctggta
taagaagttgcccaaatacntgttgctnctngcngcacttgcagcngctgtcacttacca
agccgccatgaacccncccggtgggctctggggcganggncaaantgnccacatagctgg
tgatccagttcttnggagcacctatccacgccgttataaggccttcttctactgcaacgc
gactttctttatggcttctctggt
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters