Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Arabidopsis ATH1 22k Microarray Sequence ID: 250434_at

Sequence ID: Enter a probe set ID
Sequence Type Exemplar sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for 250434_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for 250434_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments Arabidopsis alignment at TAIR
Probe Set Annotation Affymetrix annotation, 2009-03-11
histone H3 - like protein histone H3, Arabidopsis thaliana, PIR:S06250
Annotation via Blast BLASTX UniProt:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
UniRef90_E9IYV7:Putative uncharacterized protein (Fragment) n=1 Tax=Solenopsis invicta RepID=E9IYV7_SOLIN 2e-58 117/136 86 view
UniRef90_E0V960:Histone H3, putative n=2 Tax=Pediculus humanus corporis RepID=E0V960_PEDHC 2e-58 117/136 86 view
UniRef90_C3Z881:Putative uncharacterized protein n=2 Tax=Branchiostoma floridae RepID=C3Z881_BRAFL 2e-58 117/136 86 view
UniRef90_B0WZ74:Histone H3c n=1 Tax=Culex quinquefasciatus RepID=B0WZ74_CULQU 2e-58 117/136 86 view
UniRef90_A7S708:Predicted protein n=1 Tax=Nematostella vectensis RepID=A7S708_NEMVE 2e-58 117/136 86 view
show best hit only

BLASTN TIGR Plant Transcript Assemblies: TA26393_3702, RING-H2 finger protein ATL5F [Arabidopsis thaliana (Mouse-ear cress)], Expect:0, match=411/411. Blast executed on 2007-10-23 against TIGR TA Arabidopsis thaliana release 2 show top hits

BLASTX NCBI Reference Sequence: XP_002892490, histone H3 [Arabidopsis lyrata subsp. lyrata], Expect:7e-60, match=119/136. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Arabidopsis thaliana Gene Index: TC396348, UniRef100_P08903 Cluster: Histone H3.2; n=1; Encephalartos altensteinii|Rep: Histone H3.2 - Encephalartos altensteinii (Altenstein's bread tree) (Cycad), complete, Expect:0, match=1984/410. Blast executed on 2010-11-03 against AtGI(DFCI) release 15 show top hits

BLASTX Arabidopsis thaliana genome: AT5G65360.1, | Symbols: | Histone superfamily protein | chr5:26120099-26120509 REVERSE LENGTH=137, Expect:1e-60, match=119/136. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 411
>250434_at at|At5g10390; histone H3 - like protein histone H3, Arabidopsis thaliana, PIR:S06250
atggctcgtactaagcaaaccgcgaggaaatccacaggaggcaaagcaccaagaaagcaa
ctcgcaaccaaggcggcaaggaaatctgctccggccaccggaggagtgaagaagccgcat
agattccgtccaggaactgttgccttgagagagatcaggaagtatcagaagagcactgag
cttctgatccgtaagcttcctttccagcgtctggttcgtgagatagctcaggatttcaag
acggatctgaggtttcagagcagtgctgttgctgctttacaagaggctgctgaggcttac
cttgttggtttgtttgaagacactaatctttgcgccattcacgctaagagggtcaccatc
atgcctaaggatatccagctcgcgaggagaatcagaggagaaagagcttga
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters