Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Soybean 61k Heterodera glycines Sequence ID: HgAffx.10166.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for HgAffx.10166.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for HgAffx.10166.1.S1_at

Alignments and Assemblies PLEXdb Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:CB378335 /DB_XREF=gi:29127631 /DB_XREF=rq10g01.y1 /TID=HgAffx.10166.1 /CNT=4 /FEA=EST /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /REP_ORG=H. glycines
Annotation via Blast BLASTX UniProt: UniRef90_F1L0C4, Seryl-tRNA synthetase n=1 Tax=Ascaris suum RepID=F1L0C4_ASCSU, Expect:1e-105, match=193/293. Blast executed on 2012-01-23 against Uniref90 (Release: 2011_12, 14-Dec-2011) show top hits

BLASTN TIGR Plant Transcript Assemblies: No hits

BLASTX NCBI Reference Sequence:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
XP_002976614:hypothetical protein SELMODRAFT_105474 [Selaginella moellendorffii] 1e-60 133/295 45.1 view
XP_001692030:seryl-trna synthetase [Chlamydomonas reinhardtii] 3e-60 132/300 44 view
XP_002973290:hypothetical protein SELMODRAFT_99251 [Selaginella moellendorffii] 6e-60 131/295 44.4 view
XP_002950308:hypothetical protein VOLCADRAFT_81049 [Volvox carteri f. nagariensis] 6e-59 132/300 44 view
XP_001754430:predicted protein [Physcomitrella patens subsp. patens] 3e-58 135/294 45.9 view
show best hit only

BLASTN DFCI Soybean Gene Index: No hits

BLASTX Arabidopsis thaliana genome: AT5G27470.1, | Symbols: | seryl-tRNA synthetase / serine--tRNA ligase | chr5:9695087-9697154 FORWARD LENGTH=452, Expect:7e-54, match=123/297. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Additional Annotations
Sequence Total length: 881
>HgAffx.10166.1.S1_at gb|CB378335;
gaaaagggaggcgatcctgaacaaattcgcaaatctcaagtgggccgnttcgcagatgtt
tcattagtggacaaagtgatttcggcggactccgaatggcgaaaagagcgtttctttttg
gacggtttgaatcgtgcgataaaagtgtgcagtactgcgattggtgacaaaatgaagaag
aaagagtcggctggtgactccgatgccattccggaaggacaaatcaaatcacttgcagaa
ctgaaaatggatgacatcaaagaaatgaaaatttcgcaaattaaaacagtcaagggaatg
gtggacgaagaagtcagacggaccaaactcagaatggaaacgcttgagggggacagaaat
gagcatttggccaaaattgggaatttgctgcataattcggtgcccatcagtgacaatgaa
gacgaaaatcgagtcgaacggacatttggcgactgcgcaagcagaaaaagttattctcat
gttgacctcgtggtgatgtgcgacggatttgacggagagagaggcaccaatgtggcggga
ggacgaggctattttctgaaaggaccgttggtgttccttgaacaagcgctcatcgcattg
gcattgcaaatgctcaacaaaaagggcttcacgccgctttacacgcccttttttatgcgc
aaagacgtaatgcaggaggtggcacaactcagccaattcgacgaagagctttacaaggtg
accaccgcaaaaaagacggacgcagccaatgaagacggctctcccgacgagaaatatcta
atcgcaacttctgagcagccaatcgccgcctttcatcgtgacgaatggcttaacccatcg
gatttgccaatcaaatatgccggaatgtccacctgttttcg
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters