Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Tomato 10k Microarray Sequence ID: Les.1030.1.S1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment

EXPRESSION DETAILS for Les.1030.1.S1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Les.1030.1.S1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast TAIR Blast
Model Genome Alignments None available
Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:BM409800 /DB_XREF=gi:18261430 /DB_XREF=EST584127 /CLONE=cLEG50M15 /TID=Les.1030.1 /CNT=7 /FEA=EST /TIER=ConsEnd /STK=0 /UG=Les.1030 /UG_TITLE=Transcribed locus, moderately similar to NP_564250.1 Arabidopsis thaliana At1g26550 gene /REP_ORG=L. esculentum
Annotation via Blast BLASTX UniProt:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
UniRef90_D2VGQ1:Predicted protein (Fragment) n=1 Tax=Naegleria gruberi RepID=D2VGQ1_NAEGR 1e-17 42/72 58.3 view
UniRef90_B0X1I8:Peptidyl-prolyl cis-trans isomerase NIMA-interacting 4 n=1 Tax=Culex quinquefasciatus RepID=B0X1I8_CULQU 8e-11 39/73 53.4 view
UniRef90_F4X6L2:Peptidyl-prolyl cis-trans isomerase NIMA-interacting 4 n=4 Tax=Formicidae RepID=F4X6L2_ACREC 8e-11 37/71 52.1 view
UniRef90_E9FRU0:Putative uncharacterized protein n=1 Tax=Daphnia pulex RepID=E9FRU0_DAPPU 2e-10 37/73 50.7 view
UniRef90_G3MLG2:Putative uncharacterized protein n=1 Tax=Amblyomma maculatum RepID=G3MLG2_9ACAR 2e-10 37/71 52.1 view
show best hit only

BLASTN TIGR Plant Transcript Assemblies: TA41911_4081, Cluster: Putative peptidyl-prolyl cis-trans isomerase; n=1; Gossypium hirsutum|Rep: Putative peptidyl-prolyl cis-trans isomerase - Gossypium hirsutum (Upland cotton) (Gossypium mexicanum), Expect:0, match=427/427. Blast executed on 2007-10-23 against Solanum lycopersicum release 5 show top hits

BLASTX NCBI Reference Sequence: XP_002514732, rotamase, putative [Ricinus communis], Expect:2e-36, match=69/91. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTN DFCI Tomato Gene Index: TC217868, similar to UniRef100_A7DX10 Cluster: Parvulin-type peptidyl-prolyl cis/trans isomerase; n=1; Lotus japonicus|Rep: Parvulin-type peptidyl-prolyl cis/trans isomerase - Lotus japonicus, partial (97%), Expect:0, match=876/426. Blast executed on 2010-11-03 against LeGI(DFCI) release 13 show top hits

BLASTX Arabidopsis thaliana genome: AT1G26550.1, | Symbols: | FKBP-like peptidyl-prolyl cis-trans isomerase family protein | chr1:9171800-9172716 FORWARD LENGTH=143, Expect:4e-37, match=67/73. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 427
>Les.1030.1.S1_at gb|BM409800
cagtctngcctctctcaagttggaaaccctctctctctcaattgtcaaacaatcaaattc
tgagttgtaaagcttcagaagttatgggaaaggactccaagtctaaggattctggaagca
agggaaagggtaaacaggctgctggtggaagtgaggataatgcttcgaaaggaaaaggaa
aaggtgggaaaggagatggccttggaacctgcacatatgttaaagcaaggcatgtcttat
gtgagaagcagtcaaagattaatgaagcatacaaaatactacaggaaggctggctgaaca
acggagataaagttccaccagctgagtttgctaaggtagctgcaacttactcggaatgcc
cctcaggaaagaaaggtggggacctgggatggtttccacgtggcaagatggcaggcccat
ttcagga
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters