Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 58k NSF Array Microarray Sequence ID: MZ00018754

Sequence ID: Enter a probe set ID
Array provider NSF Maize Oligonucleotide Array Project  
Sequence Type TIGR Oligo ID: TM00018754; Operon ID: MZ00018754; Derived from sequence: TC293633.
Probe Set Details MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V1)
No expression data available for MZ00018754
Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os05g50960.1, polygalacturonase, putative, expressed, Expect:1e-105, match=178/218. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g43750.1, , Expect:2e-92, match=155/218. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation TIGR ricearray.org, 2007-03-13
"putative polygalacturonase {Oryza sativa (japonica cultivar-group);} "
Annotation via Blast BLASTX UniProt: UniRef90_B6TDS0, Polygalacturonase n=1 Tax=Zea mays RepID=B6TDS0_MAIZE, Expect:1e-121, match=215/218. Blast executed on 2009-07-02 against Uniref90 (July '09) show top hits

BLASTN TIGR Plant Transcript Assemblies:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
TA180454_4577: 0 878/879 99.9 view
TA180454_4577: 0 878/879 99.9 view
DR805231: 0 610/610 95.9 view
DR805231: 0 610/610 95.9 view
DY538129: 0 472/472 94.1 view
show best hit only

BLASTX NCBI Reference Sequence: NP_001149385, LOC100283011 [Zea mays], Expect:1e-124, match=215/218. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os05g50960.1, polygalacturonase, putative, expressed, Expect:1e-105, match=178/218. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC474500, , Expect:0, match=1576/877. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g43750.1, , Expect:2e-92, match=155/218. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G23820.1, | Symbols: | Pectin lyase-like superfamily protein | chr4:12397217-12400050 REVERSE LENGTH=445, Expect:3e-77, match=125/218. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1592
>MZ00018754 MZ00018754 TC225772
GGGATCTTGTCCCCTCCTGCTCGTCGCTTCCCTCACTCTCACAGCCACGCCACGCCACGA
GAGAAGAATGCCGCCGACGCTGGGCCTGCTCCTCGCGGCGGCGGCGGCGGTCCTGCTGCT
GCTGCTGCCGCCGCCACCATCGGCGGGGGCGCAGGAGACGTGCTGGTTGGGGCCGGCGCC
GCGGCGCGGGGCGTGGATGTCCGTGGCCAGCTTCGGGGCGCGCGGGGACGGGCAGACGCT
CAACACGGGCGCGTTCGCGCGCGCCGTGGCGCGCATCGCGCGTCGCCGGGGCGCGCGGGG
CGGCACGCTGCTGTACGTGCCGCCCGGGGTGTGGCTCACGGGCCCCTTCAACCTCACCTC
CCACATGACGCTCTTCCTCGCCCGCGGCGCCATCGTCCGCGCCACCCAGGACACGTCGAG
CTGGCCGCTCATCGACCCGCTGCCGTCGTACGGGAGAGGGCGCGAGCTGCCTGGCGGGAG
ATACATGAGCTTGATCCACGGCCACGGTCTGCAGGACGTCTTCATCACAGGTGAGAACGG
CACCATCGACGGCCAAGGCGGCGTGTGGTGGGACATGTGGAAGAAGCGCACGCTGCCCTT
CACGAGGCCGCACCTGCTGGAGCTCATGTACTCCACCGACGTCGTCGTCTCCAACCTCGT
CTTCCAGGACTCGCCGTTCTGGAACATCCACCCGGTTTACTGCAGCAACGTAGTGATAGC
AAACCTGACTGTGTTGGCGCCGCACGACTCCCCCAACACCGACGGGATCGATCTAGATTC
AAGCAGCAACGTGTGCGTCGAGGACTGCTACATCTCCGCCGGCGACGACCTGATCTCCAT
CAAGAGCGGGTGGGACGAGTACGGCGTGGCCTTCGGCCGCCCAAGCTCCGGCATCACGGT
CCGGAGGATAACCGGGTCGGGCCCGTTCGCCGGCTTCGCGGTCGGGAGCGAGACCTCGGG
CGGCGTGGAGGACGTCGTGGCCGAGCACCTGAGCTTCTCCGGCGTGGGCGTCGGGGTCCA
CGTGAAGACAAACTCGGGCAGGGGCGGCTTCATCCGGAACGTCACCGTCTCCCAGGTGAC
CCTGGACGGCGCCCGCTACGGCCTGAGGATCGCCGGCGACGTTGGGGGCCACCCCGGCGC
GTCCTACAACGCGAGCCTGCTCCCCGTCATCGACGGCGTGGCGGTCAGGAACGTCTGGGG
CCGGAACGTCCGGCAGGCCGGGCTCATACGGGGCATCAGGGACTCGGTCTTCAGTAACAT
TTGCCTCTCCAACGTGAAGCTCTATGGCATTGGCAGCGACTCCATCGGGCCGTGGAGATG
CCGAGCCGTCAGTGGCAGCGCACTCGACGTGCAACCGTCGCCATGTGCGGAGCTGGCTAG
TACGTCCGGGACAGGTTTCTGTACCTGAATCAGTTTTTCCGCCTCCTATAGCAGCAATAA
AGACGTCAGCATTTCTCCATTTTGTTCATCACCTACAGGGCCCTTTGTTTCTTTGGCAAA
CTCTTCTGCGATTCAGCTGTCACTGTTGAATTCTGCTGTTGGCAGAGGATAATCTATTTT
TACCAGCAGCCATTGCAAGAGAATTATTTTT>
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters