Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Microarray Sequence ID: Zm.1000.1.A1_at

Sequence ID: Enter a probe set ID
Sequence Type Consensus sequence
Probe Set Details Probe Sequences & Alignment
MaizeGDB Genome Browser : Mapped to B73 pseudomolecule (B73 RefGen_V2)

EXPRESSION DETAILS for Zm.1000.1.A1_at
GENE EXPRESSION VARIATION IN EXPERIMENTS for Zm.1000.1.A1_at

Alignments and Assemblies PlantGDB PUT assemblies PLEXdb Blast
Model Genome Alignments Rice Alignment at Gramene (by locus name): LOC_Os05g50960.1, polygalacturonase, putative, expressed, Expect:0, match=304/356. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

Brachypodium distachyon Alignment at Brachybase: Bradi2g43750.1, , Expect:1e-169, match=278/356. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

Probe Set Annotation Affymetrix annotation, 2009-03-11
gb:CK144426 /DB_XREF=gi:38687395 /DB_XREF=3530_1_11_1_A01.x_15 /TID=Zm.1000.1 /CNT=9 /FEA=mRNA /TIER=ConsEnd /STK=0 /UG=Zm.1000 /UG_TITLE=PCO140658 mRNA sequence /REP_ORG=Z. mays
Annotation via Blast BLASTX UniProt:
Subject Sequence Description   Expect   Identity/Match   Identity%   HSP
Details
UniRef90_A7PZL3:Probable polygalacturonase n=2 Tax=Vitis vinifera RepID=PGLR_VITVI 6e-94 164/347 47.3 view
UniRef90_A9UZX8:Predicted protein n=1 Tax=Monosiga brevicollis RepID=A9UZX8_MONBE 3e-74 145/347 41.8 view
UniRef90_E9C175:Polygalacturonase n=1 Tax=Capsaspora owczarzaki ATCC 30864 RepID=E9C175_CAPO3 1e-70 139/351 39.6 view
UniRef90_F8DDB0:Polygalacturonase n=1 Tax=Halopiger xanaduensis SH-6 RepID=F8DDB0_9EURY 4e-37 113/349 32.4 view
UniRef90_A8MAP2:Glycoside hydrolase family 28 n=1 Tax=Caldivirga maquilingensis IC-167 RepID=A8MAP2_CALMQ 8e-37 111/363 30.6 view
show best hit only

BLASTN TIGR Plant Transcript Assemblies: TA180454_4577, , Expect:0, match=1165/1165. Blast executed on 2007-10-23 against Zea mays release 5 show top hits

BLASTX NCBI Reference Sequence: NP_001149385, LOC100283011 [Zea mays], Expect:0, match=352/356. Blast executed on 2010-12-10 against NCBI RefSeq rel-44 show top hits

BLASTX MSU Rice genome: LOC_Os05g50960.1, polygalacturonase, putative, expressed, Expect:0, match=304/356. Blast executed on 2009-08-30 against Rice genome, TIGR release 6.1 show top hits

BLASTN DFCI Maize Gene Index: TC474500, , Expect:0, match=1576/1157. Blast executed on 2009-09-13 against ZmGI(DFCI) release 19 show top hits

BLASTX Brachypodium distachyon genome: Bradi2g43750.1, , Expect:1e-169, match=278/356. Blast executed on 2010-11-03 against Brachypodium distachyon genome, Brachybase release 1 show top hits

BLASTX Arabidopsis thaliana genome: AT4G23820.1, | Symbols: | Pectin lyase-like superfamily protein | chr4:12397217-12400050 REVERSE LENGTH=445, Expect:1e-144, match=227/356. Blast executed on 2010-12-10 against Arabidopsis thaliana genome, TAIR release 10 show top hits

Sequence Total length: 1271
>Zm.1000.1.A1_at gb|CK144426
cacgggccccttcaacctcacctcccacatgacgctcttcctcgcccgcggcgccatcgt
ccgcgccacccaggacacgtcgagctggccgctcatcgacccgctgccgtcgtacgggag
agggcgcgagctgcctggcgggagatacatgagcttgatccacggccacggtctgcagga
cgtcttcatcacaggtgagaacggcaccatcgacggccaaggcggcgtgtggtgggacat
gtggaagaagcgcacgctgcccttcacgaggccgcacctgctggagctcatgtactccac
cgacgtcgtcgtctccaacctcgtcttccaggactcgccgttctggaacatccacccggt
ttactgcagcaacgtagtgatagcanacctgactgtgttggcgccgcacgactcccccaa
caccgacgggatcgatctagattcaagcagcaacgtgtgcgtcgaggactgctacatctc
cgccggcgacgacctgatntccatcaagagcgggtgggacgagtacggcgtggccttcgg
ccgcccaagctccggcatcacggtccggaggataaccgggtcgggcccgttcgccggctt
cgcggtcgggagcgagacctcgggcggcgtggaggacgtcgtggccgagcacctgagctt
ctccggcgtgggcgtcggggtncacgtgaagacnaactcgggcaggggcggcttcatccg
gaacgtcaccgtctcccaggtgaccctggacggcgcccgctacggcctgaggatcgccgg
cgacgtngggggccaccccggcgcgtcctacaacgcgagcctgctccccgtcntcgacgg
cgtggcggtcaggaacgtctggggccggaacgtccggcaggccgggctcatacggggcat
cagggactcggtcttcagtaacatttgcctctccaacgtgaagctctatggcattggcag
cgactccatcgggccgtggagatgccgagccgtcagtggcagcgcactcgacgtgcaacc
gtcgccatgtgcggagctggctagtacgtccgggacaggtttctgtacctgaatcagttt
ttccgcctcctatagcagcaataaagacgtcagcatttctccattttgttcatcacctac
agggccctttgtttctttggcaaactcttctgcgattcagctgtcactgttgaattctgc
tgttggcagaggataatctatttttaccagcagccnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn
 
Copyright@2001-2013 The PLEXdb Group
All rights reserved.

For problems with the webpages contact PLEXdb webmasters