Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Arabidopsis ATH1 22k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 250434_at 13 37 AAGCAAACCGCGAGGAAATCCACAG 250434_at
2 250434_at 29 53 AATCCACAGGAGGCAAAGCACCAAG 250434_at
3 250434_at 57 81 GCAACTCGCAACCAAGGCGGCAAGG 250434_at
4 250434_at 107 131 TGAAGAAGCCGCATAGATTCCGTCC 250434_at
5 250434_at 133 157 GGAACTGTTGCCTTGAGAGAGATCA 250434_at
6 250434_at 198 222 TCCTTTCCAGCGTCTGGTTCGTGAG 250434_at
7 250434_at 257 281 AGAGCAGTGCTGTTGCTGCTTTACA 250434_at
8 250434_at 271 295 GCTGCTTTACAAGAGGCTGCTGAGG 250434_at
9 250434_at 316 340 GAAGACACTAATCTTTGCGCCATTC 250434_at
10 250434_at 327 351 TCTTTGCGCCATTCACGCTAAGAGG 250434_at
11 250434_at 343 367 GCTAAGAGGGTCACCATCATGCCTA 250434_at