Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Barley1 22k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area default area
Details about the Probe
See EST contig alignment at PlantGDB
No. Exemplar Name Probe Start End Sequence Probe Set Expression
1 Barley1_00039 Contig39_at_326 314 338 TTGAGGGTCCTAGCTGCAAGGCAAC Contig39_at
2 Barley1_00039 Contig39_at_341 329 353 GCAAGGCAACCGTGGAACTTCGTGA Contig39_at
3 Barley1_00039 Contig39_at_430 418 442 GATGAAGCAGATCCCTTTCTGGCTC Contig39_at
4 Barley1_00039 Contig39_at_516 504 528 AGACGTGGAGTTTCATGGCTCTGCT Contig39_at
5 Barley1_00039 Contig39_at_530 518 542 ATGGCTCTGCTGTTCTTATTGTCAG Contig39_at
6 Barley1_00039 Contig39_at_617 605 629 TCCTCGACAAGGTAGCTGGCCTGAA Contig39_at
7 Barley1_00039 Contig39_at_646 634 658 GAAAGCCTGATAGTTCCATCCGTGT Contig39_at
8 Barley1_00039 Contig39_at_705 693 717 AGAGCTGCGTCGAGTCGTGTGACCC Contig39_at
9 Barley1_00039 Contig39_at_723 711 735 GTGACCCGACACAGATTTGATCATA Contig39_at
10 Barley1_00039 Contig39_at_812 800 824 AAAATGTTGTTCGATGGCACTCCAT Contig39_at
11 Barley1_00039 Contig39_at_856 844 868 GAAGATCTGCTTGTAACCGTGAAAA Contig39_at