Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Medicago 61k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 Sme.1888.1.S1_at 124 148 TTTCTTTCCGAGTACGGAGCGCGTA Sme.1888.1.S1_at
2 Sme.1888.1.S1_at 247 271 GGCATCGATGTCGAGACCGCGCATG Sme.1888.1.S1_at
3 Sme.1888.1.S1_at 292 316 AACACGTCGAAGATCCTTGCCGAGG Sme.1888.1.S1_at
4 Sme.1888.1.S1_at 329 353 TTGCGCTTGCACTGAGCATTTCGGC Sme.1888.1.S1_at
5 Sme.1888.1.S1_at 375 399 CCACGATTTCGTGCGCGAGGGCAAG Sme.1888.1.S1_at
6 Sme.1888.1.S1_at 422 446 TCGGCCGCTCGCTGAGATCGATGAA Sme.1888.1.S1_at
7 Sme.1888.1.S1_at 458 482 TCGGGCTTGGACATATCGGCTCGGC Sme.1888.1.S1_at
8 Sme.1888.1.S1_at 523 547 TATTACGGCCCGAGACGGAAGCCTG Sme.1888.1.S1_at
9 Sme.1888.1.S1_at 677 701 AAGGCTATCTGGTGAACGTCTCGCG Sme.1888.1.S1_at
10 Sme.1888.1.S1_at 708 732 GATCGTCGACGAACAGGCGCTCATC Sme.1888.1.S1_at
11 Sme.1888.1.S1_at 764 788 TGGCCCTCGACGTCTTTGAGAAGGA Sme.1888.1.S1_at