Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Soybean 61k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 HgAffx.10166.1.S1_at 382 406 AATTTGCTGCATAATTCGGTGCCCA HgAffx.10166.1.S1_at
2 HgAffx.10166.1.S1_at 393 417 TAATTCGGTGCCCATCAGTGACAAT HgAffx.10166.1.S1_at
3 HgAffx.10166.1.S1_at 472 496 TATTCTCATGTTGACCTCGTGGTGA HgAffx.10166.1.S1_at
4 HgAffx.10166.1.S1_at 571 595 GTGTTCCTTGAACAAGCGCTCATCG HgAffx.10166.1.S1_at
5 HgAffx.10166.1.S1_at 585 609 AGCGCTCATCGCATTGGCATTGCAA HgAffx.10166.1.S1_at
6 HgAffx.10166.1.S1_at 640 664 TACACGCCCTTTTTTATGCGCAAAG HgAffx.10166.1.S1_at
7 HgAffx.10166.1.S1_at 682 706 GCACAACTCAGCCAATTCGACGAAG HgAffx.10166.1.S1_at
8 HgAffx.10166.1.S1_at 704 728 AAGAGCTTTACAAGGTGACCACCGC HgAffx.10166.1.S1_at
9 HgAffx.10166.1.S1_at 750 774 TGAAGACGGCTCTCCCGACGAGAAA HgAffx.10166.1.S1_at
10 HgAffx.10166.1.S1_at 778 802 CTAATCGCAACTTCTGAGCAGCCAA HgAffx.10166.1.S1_at
11 HgAffx.10166.1.S1_at 827 851 GGCTTAACCCATCGGATTTGCCAAT HgAffx.10166.1.S1_at