Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Soybean 61k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 PsAffx.7TMS-1_s_at 627 651 AACGTGGGCGTTTATCACCATATCC PsAffx.7TMS-1_s_at
2 PsAffx.7TMS-1_s_at 642 666 CACCATATCCTCAAGTTCCTGTATA PsAffx.7TMS-1_s_at
3 PsAffx.7TMS-1_s_at 662 686 GTATATGGATCCTATGGCGCCACGC PsAffx.7TMS-1_s_at
4 PsAffx.7TMS-1_s_at 777 801 GACCACACGGCGAATGAGTTTCTAA PsAffx.7TMS-1_s_at
5 PsAffx.7TMS-1_s_at 805 829 TGATGGAGAGCGTCTGCGACCCGTT PsAffx.7TMS-1_s_at
6 PsAffx.7TMS-1_s_at 827 851 GTTGCAGCCACTATTGAACGCAGTG PsAffx.7TMS-1_s_at
7 PsAffx.7TMS-1_s_at 843 867 AACGCAGTGGCGTACGGCACGAACA PsAffx.7TMS-1_s_at
8 PsAffx.7TMS-1_s_at 888 912 AAGGAACGGTTCTGCCCGTGCTGGA PsAffx.7TMS-1_s_at
9 PsAffx.7TMS-1_s_at 941 965 AGAAGAGTCCTCTGGCATCGACGAG PsAffx.7TMS-1_s_at
10 PsAffx.7TMS-1_s_at 1008 1032 TTGGACCCTTTAGACCGCGAGTTCG PsAffx.7TMS-1_s_at
11 PsAffx.7TMS-1_s_at 1118 1142 AATACGGCTTGGCACGAACGCTCAG PsAffx.7TMS-1_s_at