Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 Zm.1000.1.A1_at 897 921 GCATCAGGGACTCGGTCTTCAGTAA Zm.1000.1.A1_at
2 Zm.1000.1.A1_at 912 936 TCTTCAGTAACATTTGCCTCTCCAA Zm.1000.1.A1_at
3 Zm.1000.1.A1_at 926 950 TGCCTCTCCAACGTGAAGCTCTATG Zm.1000.1.A1_at
4 Zm.1000.1.A1_at 942 966 AGCTCTATGGCATTGGCAGCGACTC Zm.1000.1.A1_at
5 Zm.1000.1.A1_at 1011 1035 ACGTGCAACCGTCGCCATGTGCGGA Zm.1000.1.A1_at
6 Zm.1000.1.A1_at 1027 1051 ATGTGCGGAGCTGGCTAGTACGTCC Zm.1000.1.A1_at
7 Zm.1000.1.A1_at 1065 1089 GTACCTGAATCAGTTTTTCCGCCTC Zm.1000.1.A1_at
8 Zm.1000.1.A1_at 1082 1106 TCCGCCTCCTATAGCAGCAATAAAG Zm.1000.1.A1_at
9 Zm.1000.1.A1_at 1102 1126 TAAAGACGTCAGCATTTCTCCATTT Zm.1000.1.A1_at
10 Zm.1000.1.A1_at 1115 1139 ATTTCTCCATTTTGTTCATCACCTA Zm.1000.1.A1_at
11 Zm.1000.1.A1_at 1138 1162 TACAGGGCCCTTTGTTTCTTTGGCA Zm.1000.1.A1_at
12 Zm.1000.1.A1_at 1153 1177 TTCTTTGGCAAACTCTTCTGCGATT Zm.1000.1.A1_at
13 Zm.1000.1.A1_at 1169 1193 TCTGCGATTCAGCTGTCACTGTTGA Zm.1000.1.A1_at
14 Zm.1000.1.A1_at 1183 1207 GTCACTGTTGAATTCTGCTGTTGGC Zm.1000.1.A1_at
15 Zm.1000.1.A1_at 1211 1235 GGATAATCTATTTTTACCAGCAGCC Zm.1000.1.A1_at