Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 Zm.19219.1.A1_at 799 823 AGCGATTTTGTGATGGTGGTGCCCC Zm.19219.1.A1_at
2 Zm.19219.1.A1_at 817 841 GTGCCCCTCGGGTAATCAATGGATG Zm.19219.1.A1_at
3 Zm.19219.1.A1_at 835 859 ATGGATGCCTTCGAACATTTGTAAA Zm.19219.1.A1_at
4 Zm.19219.1.A1_at 908 932 GTGAACCTTTGCAAATACCCTGAAT Zm.19219.1.A1_at
5 Zm.19219.1.A1_at 928 952 TGAATCGTACAACAGAATGGTGGCT Zm.19219.1.A1_at
6 Zm.19219.1.A1_at 983 1007 GTCTTGGAGTTCCAGCAACCACATT Zm.19219.1.A1_at
7 Zm.19219.1.A1_at 1049 1073 AACAAACATGCTGGGCTCATCAAGG Zm.19219.1.A1_at
8 Zm.19219.1.A1_at 1085 1109 GTTCATTCTTTCAGAGTGATCGGTT Zm.19219.1.A1_at
9 Zm.19219.1.A1_at 1110 1134 ATTGGGTGAAGTATACAGGGCTGTA Zm.19219.1.A1_at
10 Zm.19219.1.A1_at 1133 1157 TAAACTGGTGGTGCACATCCATCCT Zm.19219.1.A1_at
11 Zm.19219.1.A1_at 1150 1174 TCCATCCTCCATCTGAAACAACTGA Zm.19219.1.A1_at
12 Zm.19219.1.A1_at 1167 1191 ACAACTGAGGGTTATCGCTTCTGAT Zm.19219.1.A1_at
13 Zm.19219.1.A1_at 1256 1280 AAAATGTTCTGCTTATCATAGGCTT Zm.19219.1.A1_at
14 Zm.19219.1.A1_at 1266 1290 GCTTATCATAGGCTTATTGCACTGG Zm.19219.1.A1_at
15 Zm.19219.1.A1_at 1282 1306 TTGCACTGGGAGCTGGATAATTCTA Zm.19219.1.A1_at