Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 ZmAffx.15.1.A1_at 40 64 TTAGCCTTCAACCTAAGGGAATCTA ZmAffx.15.1.A1_at
2 ZmAffx.15.1.A1_at 65 89 AAAGGTAAACATGATGGACTCATCA ZmAffx.15.1.A1_at
3 ZmAffx.15.1.A1_at 77 101 GATGGACTCATCAAGGAGCCACAAC ZmAffx.15.1.A1_at
4 ZmAffx.15.1.A1_at 86 110 ATCAAGGAGCCACAACACGTTCATT ZmAffx.15.1.A1_at
5 ZmAffx.15.1.A1_at 89 113 AAGGAGCCACAACACGTTCATTCTT ZmAffx.15.1.A1_at
6 ZmAffx.15.1.A1_at 92 116 GAGCCACAACACGTTCATTCTTTTA ZmAffx.15.1.A1_at
7 ZmAffx.15.1.A1_at 96 120 CACAACACGTTCATTCTTTTAGAAT ZmAffx.15.1.A1_at
8 ZmAffx.15.1.A1_at 115 139 TAGAATGTTCGGTTATTAGGGTGGA ZmAffx.15.1.A1_at
9 ZmAffx.15.1.A1_at 129 153 ATTAGGGTGGAAGGTATACAGAGCT ZmAffx.15.1.A1_at
10 ZmAffx.15.1.A1_at 146 170 ACAGAGCTGTAAACCGGTGATGCAC ZmAffx.15.1.A1_at
11 ZmAffx.15.1.A1_at 156 180 AAACCGGTGATGCACATTCATGCTT ZmAffx.15.1.A1_at
12 ZmAffx.15.1.A1_at 161 185 GGTGATGCACATTCATGCTTCATCT ZmAffx.15.1.A1_at
13 ZmAffx.15.1.A1_at 173 197 TCATGCTTCATCTAAAACAACCGAA ZmAffx.15.1.A1_at
14 ZmAffx.15.1.A1_at 189 213 ACAACCGAAGGTTATGGCTTCTAAG ZmAffx.15.1.A1_at
15 ZmAffx.15.1.A1_at 196 220 AAGGTTATGGCTTCTAAGCCTCTCG ZmAffx.15.1.A1_at