Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Maize 18k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 ZmAffx.15.1.S1_at 35 59 AGGCTTAGAAGCCATAACCTTCGGT ZmAffx.15.1.S1_at
2 ZmAffx.15.1.S1_at 47 71 CATAACCTTCGGTTGTTTTAGATGA ZmAffx.15.1.S1_at
3 ZmAffx.15.1.S1_at 70 94 GAAGCATGAATGTGCATCACCGGTT ZmAffx.15.1.S1_at
4 ZmAffx.15.1.S1_at 77 101 GAATGTGCATCACCGGTTTACAGCT ZmAffx.15.1.S1_at
5 ZmAffx.15.1.S1_at 83 107 GCATCACCGGTTTACAGCTCTGTAT ZmAffx.15.1.S1_at
6 ZmAffx.15.1.S1_at 92 116 GTTTACAGCTCTGTATACCTTCCAC ZmAffx.15.1.S1_at
7 ZmAffx.15.1.S1_at 101 125 TCTGTATACCTTCCACCCTAATAAC ZmAffx.15.1.S1_at
8 ZmAffx.15.1.S1_at 112 136 TCCACCCTAATAACCGAACATTCTA ZmAffx.15.1.S1_at
9 ZmAffx.15.1.S1_at 138 162 AAGAATGAACGTGTTGTGGCTCCTT ZmAffx.15.1.S1_at
10 ZmAffx.15.1.S1_at 141 165 AATGAACGTGTTGTGGCTCCTTGAT ZmAffx.15.1.S1_at
11 ZmAffx.15.1.S1_at 149 173 TGTTGTGGCTCCTTGATGAGTCCAT ZmAffx.15.1.S1_at
12 ZmAffx.15.1.S1_at 155 179 GGCTCCTTGATGAGTCCATCATGTT ZmAffx.15.1.S1_at
13 ZmAffx.15.1.S1_at 166 190 GAGTCCATCATGTTTACCTTTTAGA ZmAffx.15.1.S1_at
14 ZmAffx.15.1.S1_at 172 196 ATCATGTTTACCTTTTAGATTCCCT ZmAffx.15.1.S1_at
15 ZmAffx.15.1.S1_at 187 211 TAGATTCCCTTAGGTTGAAGGCTAA ZmAffx.15.1.S1_at