Search   for 
Find Your Gene ·  Publications ·  Tools ·  Gene List Suite ·  Expression Atlases ·  About PLEXdb ·  Feedback
Login ID:
Password:
Plants
Arabidopsis
Barley
Brachypodium
Citrus
Cotton
Grape
Maize
Medicago
Poplar
Rice
Soybean
Sugarcane
Tomato
Wheat
Pathogens & Symbionts
Search Experiments
Download Data
Gene List Suite
Tools
Your Account
Documentation
News
Personnel
Links
 Data Release Policy 
PLEXdb is committed to making expression data publicly available to researchers world-wide...
complete policy
 

Tomato 10k Probe Alignments

Probe set name:

diagram
area area area area area area area area area area area area default area
Details about the Probe
No. Exemplar Name Start End Sequence ProbeSet Expression
1 Les.1030.1.S1_at 53 77 TCAAATTCTGAGTTGTAAAGCTTCA Les.1030.1.S1_at
2 Les.1030.1.S1_at 91 115 AGGACTCCAAGTCTAAGGATTCTGG Les.1030.1.S1_at
3 Les.1030.1.S1_at 192 216 GGAGATGGCCTTGGAACCTGCACAT Les.1030.1.S1_at
4 Les.1030.1.S1_at 198 222 GGCCTTGGAACCTGCACATATGTTA Les.1030.1.S1_at
5 Les.1030.1.S1_at 223 247 AAGCAAGGCATGTCTTATGTGAGAA Les.1030.1.S1_at
6 Les.1030.1.S1_at 275 299 AATACTACAGGAAGGCTGGCTGAAC Les.1030.1.S1_at
7 Les.1030.1.S1_at 285 309 GAAGGCTGGCTGAACAACGGAGATA Les.1030.1.S1_at
8 Les.1030.1.S1_at 304 328 GAGATAAAGTTCCACCAGCTGAGTT Les.1030.1.S1_at
9 Les.1030.1.S1_at 312 336 GTTCCACCAGCTGAGTTTGCTAAGG Les.1030.1.S1_at
10 Les.1030.1.S1_at 333 357 AAGGTAGCTGCAACTTACTCGGAAT Les.1030.1.S1_at
11 Les.1030.1.S1_at 350 374 CTCGGAATGCCCCTCAGGAAAGAAA Les.1030.1.S1_at