PLEXdb Glossary

Absolute Analysis: The qualitative analysis of a single array to determine if a transcript is Present, Absent or Marginal. 

Affymetrix tab-delimited format of the probe sequence download file:

The probe sequence download file in the Download Center is a tab-delimited file containing the following columns:

Probe Set Name: For example, 1007_s_at

Probe X: The X coordinate of the probe sequence on the GeneChip® probe array.

Probe Y: The Y coordinate of the probe sequence on the GeneChip probe array.

Probe Interrogation Position: The position of the 13th ("middle") nucleotide of the probe sequence as it aligns on the consensus/exemplar sequence.

Probe Sequence: The 25-base perfect match sequence.

Target Strandedness: The sense/antisense orientation of the target sequence that can hybridize with the probe sequence.

Note: Probe Sequence databanks in the NetAffx™ Analysis Center have an additional column called, "Serial Order". This column provides the relative order of probe sequences as they align with the consensus/exemplar sequence.  

Array: A collection of probes on glass encased in a plastic cartridge.

Average Difference: A quantitative relative indicator of the level of expression of a transcript.

Background: A measurement of signal intensity caused by autofluoresence of array surface and non-specific binding of target/stain molecules (SAPE).

Base: Nucleic acids are biological macromolecules. Sugar and phosphate groups form an uniform backbone (the phosphate groups are actually the acids). Variable side chains are attached to each sugar. The side chains of DNA are either of four nitrogenous bases: two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). RNA comprises uracil instead of thymine.

Baseline Array: An array designated as the baseline when being analyzed in comparison analysis with which the experimental array is compared to detect changes in expression. For example, if the baseline file is derived from a treated sample and the experiment from an untreated sample, all genes activated by the treatment will have decrease calls.

Chip: See Array

Clone: A colony of cells that are hosting a piece of foreign DNA. Breading one cell from a clone is a common technique to amplify the foreign DNA. (In general, a clone is a colony of genetically identical cells that are all descendents from a single anchestor cell.)

Comparative Analysis: The analysis of an experimental array compared to a baseline array.

Decision Matrix: An algorithm that examines a collection of metrics used to determine the status of a hybridized transcript.

Detection: A quantitative measurement indicating if the transcript is detected (Present), not detected (Absent), or marginally detected (Marginal).

Empirical Algorithms: The algorithms contained in GeneChip Analysis Suite and Microarray Suite 4.0 based on empirical data generated by Affymetrix.

Experimental Array: An array that is used in comparison analysis to be compared to the baseline array to detect changes in expression. For example, if the baseline file is derived from an untreated sample and the experiment from a treated sample, all genes activated by the treatment will have increase calls.

FASTA:

A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. It is recommended that all lines of text be shorter than 80 characters in length. An example sequence in FASTA format is:
>exemplar:AtGenome1:16876_at; gb|AL023094; AL023094 /FEATURE=cds-2 /GENE=T4L20.20 /LABEL= /PRODUCT= putative serine/threonine protein kinase  /STRAND=forward /DEFINITION=Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project).

atggcggactcaccggtggattcatctcctgcccctgaaacctcaaatgggacaccaccg  

tcaaacggaacatcgccgtctaatgagtcatcgccgccaacaccaccttcttcaccacca
… …

gaagaaatgaatagaggctcaatgaaacgcaatcctcagctttga

Feature: A single square-shaped probe cell on an array (another term for probe cell). A feature ranges in size from 18 to 50 microns depending on the array type.

Gene: Genes are composed of deoxyribonucleic acid (DNA), except in some viruses, which have genes consisting of a closely related compound called ribonucleic acid (RNA). A DNA molecule is composed of two chains of nucleotides that wind about each other resembling a twisted ladder.

GeneChip Unit Type/Probe Set Name Designations:

• _at : antisense target
• _st : sense target
• _s_at : similarity constraint
• _g_at: common groups
• _r_at: rules dropped
• _i_at : incomplete
• _b_at : ambiguous probe set
• _l_at : long probe s

Hybridization Controls: Controls added to the sample before hybridization to the array.

Labeling: Coupling a marker to a bio molecule. Markers are organic dyes or naoparticles (beads) that are chemically (covalently) bound to a bio molecule. Pure bio molecules are hard to detect by optical methods, but labeled molecules can be detected with customary spectroscopic devices.

Mask: Filter used during synthesis of a GeneChip array that exposed discreet areas of a wafer to ultraviolet light.

Mismatch Probe (MM): A 25-mer oligonucleotide designed to be complementary to a reference sequence except for a single, homomeric (nucleotide mismatch that contains the complementary base to the original) base change at the 13th position. Mismatch probes serve as specificity controls when compared to their corresponding Perfect Match probes.

Normalization: Adjusting an average value of an experimental array equal to that of the baseline array so that the arrays can be compared.

Photolithography: The process used to manufacture probe arrays in conjunction with combinatorial chemistry through a series of cycles. Using light, photolabile protection groups are removed from linkers bound to the glass substrate (wafer) to enable nucleotide phosphoramidite addition in specific deprotected locations. Each light exposure and subsequent phosphoramidite addition is equal to one cycle. Typically, probe arrays are synthesized in about 80 cycles.

Probe: A 25-mer oligonucleotide designed to be complementary to a reference sequence. The probe sequence that is complementary to the sequence to be hybridized.

Probe Array Tiling: The spatial organization of probe array features into probe paires and sets.

Probe Cell: A single square-shaped feature on an array containing probes with a unique sequence. A probe cell ranges in size from 18 to 50 microns per side depending on the array type.

Probe Pair: Two features within a probe set. Each probe of a probe pair is designed to differ only at the nucleotide base interrogation position. The probe pair is designed to detect a Perfect Match (PM) and a Mismatch (MM).

Probe Set: A collection of probe pairs which interrogates the same sequence, or set of sequences. A probe set typically contains between 11 to 20 probe pairs.

SAPE: Streptavidin-phycoerythin dye used to bind the biotin. In the GeneChip Expression Assay, the biotinylated nucleotides are incorporated into the cRNA during the in vitro transcription (IVT) reaction.

Scaling: Adjusting the average intensity or signal value of every array to a common value (target intensity) in order to make the arrays comparable.

Spike Controls: Controls that are added to the sample before cDNA synthesis.

Target: The sample applied as labeled (biotinylated), fragmented cRNA to a GeneChip probe array for hybridization.

Wafer: the glass substrate onto which probes are synthesized during the manufacturing of probe arrays.